Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Posted on July 23, 2024 by MaryO

Abstract

Objective

Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.

Methods

Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.

Results

In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.

Conclusion

Although the USP8–EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Peer Review reports

Introduction

Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [3, 4].

The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.

Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.

Methods

Case series

Study population

Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.

DNA extraction and Sanger sequencing

A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.

Systematic review

Overview of the systematic literature review

We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.

Search strategy

We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.

Inclusion and exclusion criteria

All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.

Results

Case series

Baseline characteristics of the participants

This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).

Frequency of USP8 gene variants

Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).

Fig. 1

figure 1

Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II

Clinical outcomes after surgery

All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).

Systematic review

The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.

Fig. 2
figure 2

Flow diagram of literature search and study selection

In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).

Table 1 Results of systematic literature review
Fig. 3

figure 3

Summary of USP8 mutations in patients with CD in selected studies

USP8 variants and the related pathways in corticotroph adenomas

In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].

Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].

Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].

A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].

DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].

Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma

Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].

In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].

A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].

USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma

Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].

In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].

A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].

Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].

Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].

The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].

Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].

Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].

Analytical conclusion

In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.

We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.

Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [6, 15]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.

Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.

Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [7, 24]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].

There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.

Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22, 25, 28, 30]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [24, 27, 42]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.

There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [30, 31]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [37, 38].

In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Data availability

The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.

Abbreviations

ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48

References

  1. Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.

  2. Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.

    Article CAS PubMed PubMed Central Google Scholar

  3. Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.

    Article CAS PubMed Google Scholar

  4. Mallari RJ, Thakur JD, Barkhoudarian G, Eisenberg A, Rodriguez A, Rettinger S, Cohan P, Nieman L, Kelly DF. Diagnostic pitfalls in Cushing Disease: Surgical Remission Rates, Test Thresholds, and lessons learned in 105 patients. J Clin Endocrinol Metab. 2022;107(1):205–18.

    Article PubMed Google Scholar

  5. Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.

    Article PubMed Google Scholar

  6. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.

    Article CAS PubMed Google Scholar

  7. Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.

    Article CAS PubMed PubMed Central Google Scholar

  8. Rebollar-Vega RG, Zuarth-Vázquez JM, Hernández-Ramírez LC. Clinical spectrum of USP8 pathogenic variants in Cushing’s Disease. Arch Med Res. 2023;54(8):102899.

    Article CAS PubMed Google Scholar

  9. Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.

    Article CAS PubMed PubMed Central Google Scholar

  10. Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.

    Article PubMed Google Scholar

  11. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.

    Article CAS PubMed PubMed Central Google Scholar

  12. Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.

  13. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.

    Article CAS PubMed Google Scholar

  14. Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.

    Article CAS PubMed Google Scholar

  15. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.

    Article CAS PubMed PubMed Central Google Scholar

  16. Martins CS, Camargo RC, Coeli-Lacchini FB, Saggioro FP, Moreira AC, de Castro M. USP8 mutations and cell cycle regulation in Corticotroph Adenomas. Horm Metab Res. 2020;52(2):117–23.

    Article CAS PubMed Google Scholar

  17. Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.

    Article CAS PubMed Google Scholar

  18. Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.

    Article CAS PubMed Google Scholar

  19. Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.

    Article PubMed PubMed Central Google Scholar

  20. Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.

    Article PubMed Google Scholar

  21. Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.

    Article PubMed Google Scholar

  22. Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.

    Article CAS PubMed PubMed Central Google Scholar

  23. Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.

    Article PubMed PubMed Central Google Scholar

  24. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.

  25. Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.

    Article CAS PubMed Google Scholar

  26. Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.

    Article CAS PubMed PubMed Central Google Scholar

  27. Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.

    Article CAS PubMed Google Scholar

  28. Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.

    Article CAS PubMed PubMed Central Google Scholar

  29. Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.

    Article CAS PubMed Google Scholar

  30. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.

    Article CAS PubMed Google Scholar

  31. Albani A, Perez-Rivas LG, Tang S, Simon J, Lucia KE, Colón-Bolea P, Schopohl J, Roeber S, Buchfelder M, Rotermund R, et al. Improved pasireotide response in USP8 mutant corticotroph tumours in vitro. Endocr Relat Cancer. 2022;29(8):503–11.

    Article CAS PubMed Google Scholar

  32. Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.

    Article CAS PubMed PubMed Central Google Scholar

  33. Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.

    Article CAS PubMed PubMed Central Google Scholar

  34. Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.

  35. Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.

    Article CAS PubMed Google Scholar

  36. Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.

    Article PubMed PubMed Central Google Scholar

  37. Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.

    Article CAS PubMed PubMed Central Google Scholar

  38. Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.

    Article CAS PubMed Google Scholar

  39. Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, Serban A, Ferrante E, Locatelli M, Lania AG, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. 2021;28(8):573–82.

    Article CAS PubMed Google Scholar

  40. Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.

    Article PubMed Google Scholar

  41. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.

    CAS PubMed Google Scholar

  42. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S. Transforming growth factor-alpha stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol. 2000;165(2):493–501.

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank all the participants enrolled in this study.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.

Author information

Author notes

  1. Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.

Authors and Affiliations

  1. Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran

    Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh

  2. Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran

    Ali Zare Mehrjardi

  3. Department of Endocrinology, Arad Hospital, Tehran, Iran

    Mahmoud Reza Kaynama

Contributions

Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad E. Khamseh.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Skip to figshare navigation

Below is the link to the electronic supplementary material.

Cite this article

Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord 24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z

Download citation

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable linkProvided by the Springer Nature SharedIt content-sharing initiative

Keywords

From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-024-01619-z

Filed under: Cushing's | Tagged: , , | Leave a comment »

Longterm-Outcomes In Patients With Cushing’s Disease vs. Non-Functioning Pituitary Adenoma After Pituitary Surgery: An Active-Comparator Cohort Study

Posted on July 22, 2024 by MaryO

Abstract

Objective

There is increasing evidence that multisystem morbidity in patients with Cushing’s disease (CD) is only partially reversible following treatment. We investigated complications from multiple organs in hospitalized patients with CD compared to patients with non-functioning pituitary adenoma (NFPA) after pituitary surgery.

Design

Population-based retrospective cohort study using data from the Swiss Federal Statistical Office between January 2012 and December 2021.

Methods

Through 1:5 propensity score matching, we compared hospitalized patients undergoing pituitary surgery for CD or NFPA, addressing demographic differences. The primary composite endpoint included all-cause mortality, major adverse cardiac events (i.e., myocardial infarction, unstable angina, heart failure, cardiac arrest, ischemic stroke), hospitalization for psychiatric disorders, sepsis, severe thromboembolic events, and fractures in need of hospitalization. Secondary endpoints comprised individual components of the primary endpoint and surgical reintervention due to disease persistence or recurrence.

Results

After matching, 116 patients with CD (mean age 45.4 years [SD, 14.4], 75.0% female) and 396 with NFPA (47.3 years [14.3], 69.7% female) were included and followed for a median time of 50.0 months (IQR 23.5, 82.0) after pituitary surgery. CD presence was associated with a higher incidence rate of the primary endpoint (40.6 vs. 15.7 events per 1,000 person-years, HR 2.75; 95% CI, 1.54 to 4.90). CD patients also showed increased hospitalization rates for psychiatric disorders (HR 3.27; 95% CI, 1.59 to 6.71) and a trend for sepsis (HR 3.15; 95% CI, 0.95 to 10.40).

Conclusions

Even after pituitary surgery, CD patients faced a higher hazard of complications, especially psychiatric hospitalizations and sepsis.

Accepted manuscripts
Accepted manuscripts are PDF versions of the author’s final manuscript, as accepted for publication by the journal but prior to copyediting or typesetting. They can be cited using the author(s), article title, journal title, year of online publication, and DOI. They will be replaced by the final typeset articles, which may therefore contain changes. The DOI will remain the same throughout.
This content is only available as a PDF.
© The Author(s) 2024. Published by Oxford University Press on behalf of European Society of Endocrinology. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.
This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/pages/standard-publication-reuse-rights)

Filed under: Cushing's, pituitary, symptoms | Tagged: , , , , | Leave a comment »

Evaluating the usefulness of plasma chromogranin A measurement in cyclic ACTH-dependent Cushing’s syndrome

Posted on July 19, 2024 by MaryO
Abstract

Cushing’s syndrome, a clinical condition characterized by hypercortisolemia, exhibits distinct clinical signs and is associated with cyclic cortisol secretion in some patients. The clinical presentation of cyclic Cushing’s syndrome can be ambiguous and its diagnosis is often challenging.

We experienced a 72-year-old woman with cyclic ACTH-dependent Cushing’s syndrome caused by a pulmonary carcinoid tumor. Diagnosis was challenging because of the extended trough periods, and the responsible lesion was initially unidentified. A subsequent follow-up computed tomography revealed a pulmonary lesion, and ectopic ACTH secretion from this lesion was confirmed by pulmonary artery sampling. Despite the short peak secretion period of ACTH (approximately one week), immunostaining of the surgically removed tumor confirmed ACTH positivity. Interestingly, stored plasma chromogranin A levels were elevated during both peak and trough periods.

The experience in evaluating this patient prompted us to investigate the potential use of plasma chromogranin A as a diagnostic marker of ACTH-dependent Cushing’s syndrome. A retrospective study was conducted to determine the efficacy of plasma chromogranin A in three patients with ectopic ACTH syndrome (EAS), including the present case, and six patients with Cushing’s disease (CD) who visited our hospital between 2018 and 2021. Notably, plasma chromogranin A levels were higher in patients with EAS than in those with CD. Additionally, a chromogranin A level in the present case during the trough phase was lower than that in the peak phase, and was similar to those in CD patients. The measurement of plasma chromogranin A levels could aid in differentiating EAS from CD.

Keywords: ACTH-dependent Cushing’s syndrome, Cyclic, Carcinoid, Pulmonary arterial sampling, Chromogranin A

From https://www.jstage.jst.go.jp/article/endocrj/advpub/0/advpub_EJ24-0128/_article

Filed under: Cancer, Cushing's, Diagnostic Testing | Tagged: , , , , | Leave a comment »

Spontaneous Cushing’s Disease Remission Induced by Pituitary Apoplexy

Posted on July 17, 2024 by MaryO

Abstract

Spontaneous remission of Cushing’s disease (CD) is uncommon and often attributed to pituitary tumor apoplexy. We present a case involving a 14-year-old female who exhibited clinical features of Cushing’s syndrome. Initial diagnostic tests indicated CD: elevated 24h urinary cortisol (235 µg/24h, n < 90 µg/24h), abnormal 1 mg dexamethasone overnight test (cortisol after 1 mg dex 3.4 µg/dL, n < 1.8 µg/dL), and elevated adrenocorticotropic hormone concentrations (83.5 pg/mL, n 10-60 pg/mL). A pituitary adenoma was suspected, so a nuclear MRI was performed, with findings suggestive of a pituitary microadenoma. The patient was referred for a transsphenoidal resection of the microadenoma. While waiting for surgery, the patient presented to the emergency department with a headache and clinical signs of meningism. A computed axial tomography of the central nervous system was performed, and no structural alterations were found. The symptoms subsided with analgesia. One month later, she presented again to the emergency department with clinical findings of acute adrenal insufficiency (cortisol level of 4.06 µg/dL), and she was noted to have spontaneous biochemical remission associated with the resolution of her symptoms of hypercortisolism. For that reason, spontaneous CD remission induced by pituitary apoplexy (PA) was diagnosed. The patient has been managed conservatively since the diagnosis and remains in clinical and biochemical remission until the present time, after 10 months of follow-up. There are three unique aspects of our case: the early age of onset of symptoms, the spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that the patient presented a microadenoma because there are fewer than 10 clinical case reports of PA associated with microadenoma.

Introduction

Cushing’s disease (CD) is characterized by excessive production of adrenocorticotropic hormone by a pituitary adenoma and represents the most common cause of endogenous Cushing’s syndrome (CS) [1]. CD was first reported in 1912 by Harvey Williams Cushing, and he described 12 cases at the Peter Bent Brigham Hospital in Baltimore [2]. This disease has a global incidence of approximately 2.2 cases per 1,000,000 people and occurs more frequently in women from 20 to 50 years of age [3]. Pituitary apoplexy (PA) is a rare condition that occurs in 2-12% of cases, and it has a high morbidity and mortality rate [4]. We report an interesting case of a woman diagnosed with CD who achieved spontaneous remission of her disease after a PA.

Case Presentation

A 14-year-old female presented with a two-year history of weight gain (32 kg), depression, elevated blood pressure, type 2 diabetes mellitus, and growth failure (height less than the third percentile). Her height was 140 cm, and her BMI was 28.1 (97th percentile). At presentation, she had not yet reached menarche. Physical examination revealed Tanner 2 breast development, acne, hirsutism, moon facies, dorsocervical fat pad, central obesity, and stretch marks. Initial laboratory tests showed hemoglobin A1C of 13%, low-density lipoprotein of 167 mg/dL, triglycerides of 344 mg/dL, high-density lipoprotein of 26 mg/dL, creatinine of 0.4 mg/dL, and elevated liver enzymes. Abdominal ultrasound indicated moderate hepatic steatosis changes.

Given the high suspicion of CS, a hormonal profile was conducted (Table 1), confirming CS and subsequently diagnosing CD. A nuclear MRI revealed a 2.6 × 1.8 mm pituitary lesion (Figure 1), prompting referral for transsphenoidal resection of the pituitary microadenoma.

Laboratories Reference range Initial One month Three months Six months
TSH (mUI/L) 0.35-4.94 – 2.17 – 2.01
AM cortisol (µg/dL) 6.02-18.4 17.3 4.06 <0.5 4.7
1 mg DST (µg/dL) <1.8 3.4 – – –
8 mg DST (µg/dL) <50% suppression 1.9 (78% suppression) – – –
Urine-free cortisol (µg/24h) <90 235 – – –
ACTH (pg/mL) 10-60 83.5 – 19.2 9.7
IGF-1 (ng/mL) 36-300 – – – 293
Table 1: Pertinent laboratory investigation at baseline and follow-up with our patient

ACTH, adrenocorticotropic hormone; DST, dexamethasone suppression test; IGF-1, insulin growth factor-1; TSH, thyroid-stimulating hormone

Axial-view-of-a-T1-MRI-with-contrast-showing-a-sellar-lesion
Figure 1: Axial view of a T1 MRI with contrast showing a sellar lesion

The red arrow shows a microadenoma in relation to the normal pituitary gland.

Approximately one month after the suppression tests and while awaiting surgery, the patient presented to the emergency department with a sudden, severe, holocranial headache accompanied by projectile vomiting and diplopia, suggestive of meningism. A computed axial tomography of the central nervous system was conducted, revealing no structural abnormalities. Symptoms resolved with intravenous analgesia within approximately four to six hours. Subsequently, the patient experienced a significant decrease in insulin requirements, ultimately leading to the suspension of insulin therapy due to persistent hypoglycemia.

Weeks after the headache episode, the patient was reevaluated in the emergency department with a three-day history of diffuse abdominal pain, vomiting, asthenia, myalgia, hypotension, tachycardia, orthostatism, and recurrent hypoglycemia despite insulin suspension. Acute adrenal insufficiency was suspected and confirmed by a cortisol level of 4.06 µg/dL. Treatment with intravenous hydrocortisone 50 mg every six hours was initiated, leading to complete resolution of symptoms within 72 hours. The patient was discharged on maintenance therapy with oral hydrocortisone (20 mg in the morning and 10 mg at night). Subsequent follow-ups showed undetectable cortisol levels. Currently, the patient has been followed up for 10 months post-event, showing persistent clinical and hormonal remission of her disease.

Discussion

CD represents approximately 80% of cases of endogenous hypercortisolism, and pituitary microadenomas are the most common cause of CD in all age groups [5]. CD prevalence is 0.3-6.2 cases per 100,000 people [3], which represents 4.4% of all pituitary adenomas [6], and it is up to five times more likely to occur in women than men. Spontaneous remission of CD is rare, and it is mainly due to the apoplexy of a pituitary tumor [7].

PA is a potentially fatal condition resulting from hemorrhage or necrosis of a pituitary adenoma that produces compression of the surrounding structures with symptoms that can be critical and even fatal [8]. PA affects between 2% and 12% of patients with pituitary adenomas, mainly in nonfunctional macroadenomas [9]. Although the main mechanism of PA is hemorrhage, it can also be due to a hemorrhagic infarction or an infarction without hemorrhage; this last scenario is clinically less aggressive [10]. Among the most important precipitating factors are craniocerebral trauma, pregnancy, thrombocytopenia, coagulopathies, pituitary stimulation tests, drugs such as anticoagulants and estrogens, surgeries that are complicated by hypotension, and radiotherapy [4,11,12].

There are three unique aspects of our case. First, the age of onset is 14 years old. This characteristic has been reported in less than 6% of cases of CD, with a mean age of onset between 12.3 and 14.1 years and a slightly higher incidence in men (63%) [13]. In this population, CD is the most common cause of hypercortisolism, accounting for 75-80% of all cases [14]. Furthermore, our patient presented a significant weight gain, severe compromise in her height, hypertension, depression, and diabetes mellitus, which is compatible with the classic profile described for CD in pediatric ages. It is important to clarify that although type 2 diabetes mellitus is common in adults, it is unusual in the pediatric population [13].

Second, spontaneous remission in CD due to apoplexy has been rarely reported in the past; hence, our case is an important addition to the scant literature on this unusual phenomenon. Although there are characteristics suggestive of PA, such as hyperdense lesions within the pituitary gland and the reinforcing ring, a CT scan has a low sensitivity for detecting pituitary hemorrhage (21-46%); therefore, a negative CT scan does not rule out PA in cases where there is infarction without hemorrhage, a situation that could correspond to our case [15].

The third unique feature of our case is that the stroke occurred in the context of a microadenoma, a situation reported in less than 10 cases in the literature. Despite being a microadenoma, the symptoms of PA were severe, with symptoms of meningism, an intense headache, vomiting, and the development of adrenal insufficiency. Taylor et al. [16] reported a similar case of a 41-year-old female with microadenoma whose PA was associated with severe headache and vomiting.

The main differential diagnosis in our case is cyclical CS (CCS), a disorder that occurs in 15% of CS cases, especially in CD [17]. The diagnosis of CCS is classically established with three peaks and two valleys in cortisol secretion, spontaneous fluctuations, and clinical features of CS [7]. The possibility of CCS was ruled out due to the typical presentation of the PA event and the persistence of hypocortisolism.

Finally, several cases of recurrence of their disease have been described after remission of CS due to AP. Those recurrences usually develop in follow-ups of up to seven years [18]. At the time of the last evaluation (10 months post-PA), the patient remained in remission, but long-term follow-up is required to detect both reactivation and hypopituitarism [19].

Conclusions

CD is a rare entity in the pediatric population, usually associated with a pituitary microadenoma. Spontaneous remission of this disease is very uncommon, but when it occurs, it is mainly due to PA. We describe a case with three unique aspects: CD with an early age of onset of symptoms, spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that there are less than 10 clinical case reports of PA associated with microadenoma. It is imperative for clinicians to be aware of this possible outcome in patients with CD.

References

  1. Fleseriu M, Auchus R, Bancos I, et al.: Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol. 2021, 9:847-75. 10.1016/S2213-8587(21)00235-7
  2. Bray DP, Rindler RS, Dawoud RA, Boucher AB, Oyesiku NM: Cushing disease: medical and surgical considerations. Otolaryngol Clin North Am. 2022, 55:315-29. 10.1016/j.otc.2021.12.006
  3. Giuffrida G, Crisafulli S, Ferraù F, et al.: Global Cushing’s disease epidemiology: a systematic review and meta-analysis of observational studies. J Endocrinol Invest. 2022, 45:1235-46. 10.1007/s40618-022-01754-1
  4. Briet C, Salenave S, Bonneville JF, Laws ER, Chanson P: Pituitary apoplexy. Endocr Rev. 2015, 36:622-45. 10.1210/er.2015-1042
  5. Newell-Price J, Bertagna X, Grossman A, Nieman L: Cushing’s syndrome. Lancet. 2006, 367:1605-17. 10.1016/S0140-6736(06)68699-6
  6. Daly AF, Beckers A: The epidemiology of pituitary adenomas. Endocrinol Metab Clin North Am. 2020, 49:347-55. 10.1016/j.ecl.2020.04.002
  7. Popa Ilie IR, Herdean AM, Herdean AI, Georgescu CE: Spontaneous remission of Cushing’s disease: a systematic review. Ann Endocrinol (Paris). 2021, 82:613-21. 10.1016/j.ando.2021.10.002
  8. Siwakoti K, Omay SB, Inzucchi SE: Spontaneous resolution of primary hypercortisolism of Cushing disease after pituitary hemorrhage. AACE Clin Case Rep. 2020, 6:e23-9. 10.4158/ACCR-2019-0292
  9. Dubuisson AS, Beckers A, Stevenaert A: Classical pituitary tumour apoplexy: clinical features, management and outcomes in a series of 24 patients. Clin Neurol Neurosurg. 2007, 109:63-70. 10.1016/j.clineuro.2006.01.006
  10. Semple PL, De Villiers JC, Bowen RM, Lopes MB, Laws ER Jr: Pituitary apoplexy: do histological features influence the clinical presentation and outcome?. J Neurosurg. 2006, 104:931-7. 10.3171/jns.2006.104.6.931
  11. Turgut M, Ozsunar Y, Başak S, Güney E, Kir E, Meteoğlu I: Pituitary apoplexy: an overview of 186 cases published during the last century. Acta Neurochir (Wien). 2010, 152:749-61. 10.1007/s00701-009-0595-8
  12. Wildemberg LE, Glezer A, Bronstein MD, Gadelha MR: Apoplexy in nonfunctioning pituitary adenomas. Pituitary. 2018, 21:138-44. 10.1007/s11102-018-0870-x
  13. Concepción-Zavaleta MJ, Armas CD, Quiroz-Aldave JE, et al.: Cushing disease in pediatrics: an update. Ann Pediatr Endocrinol Metab. 2023, 28:87-97. 10.6065/apem.2346074.037
  14. Ferrigno R, Hasenmajer V, Caiulo S, et al.: Paediatric Cushing’s disease: epidemiology, pathogenesis, clinical management and outcome. Rev Endocr Metab Disord. 2021, 22:817-35. 10.1007/s11154-021-09626-4
  15. Banerjee AK: Diagnostic imaging: Brain. 2nd edition. Br J Radiol. 2010, 83:450-1.
  16. Taylor HC, McLean S, Monheim K: Resolution of Cushing’s disease followed by secondary adrenal insufficiency after anticoagulant-associated pituitary hemorrhage: report of a case and review of the literature. Endocr Pract. 2003, 9:147-51. 10.4158/EP.9.2.147
  17. Alexandraki KI, Kaltsas GA, Isidori AM, et al.: The prevalence and characteristic features of cyclicity and variability in Cushing’s disease. Eur J Endocrinol. 2009, 160:1011-8. 10.1530/EJE-09-0046
  18. Kamiya Y, Jin-No Y, Tomita K, et al.: Recurrence of Cushing’s disease after long-term remission due to pituitary apoplexy. Endocr J. 2000, 47:793-7. 10.1507/endocrj.47.793
  19. Machado MC, Gadelha PS, Bronstein MD, Fragoso MC: Spontaneous remission of hypercortisolism presumed due to asymptomatic tumor apoplexy in ACTH-producing pituitary macroadenoma. Arq Bras Endocrinol Metabol. 2013, 57:486-9. 10.1590/s0004-27302013000600012

Filed under: Cushing's, pituitary | Tagged: , , , , , , | Leave a comment »

Whole Blood Transcriptomic Signature of Cushing’s Syndrome

Posted on July 15, 2024 by MaryO

Abstract

Objective

Cushing’s syndrome is characterized by high morbidity and mortality with high interindividual variability. Easily measurable biomarkers, in addition to the hormone assays currently used for diagnosis, could reflect the individual biological impact of glucocorticoids. The aim of this study is to identify such biomarkers through the analysis of whole blood transcriptome.

Design

Whole blood transcriptome was evaluated in 57 samples from patients with overt Cushing’s syndrome, mild Cushing’s syndrome, eucortisolism, and adrenal insufficiency. Samples were randomly split into a training cohort to set up a Cushing’s transcriptomic signature and a validation cohort to assess this signature.

Methods

Total RNA was obtained from whole blood samples and sequenced on a NovaSeq 6000 System (Illumina). Both unsupervised (principal component analysis) and supervised (Limma) methods were used to explore the transcriptome profile. Ridge regression was used to build a Cushing’s transcriptome predictor.

Results

The transcriptomic profile discriminated samples with overt Cushing’s syndrome. Genes mostly associated with overt Cushing’s syndrome were enriched in pathways related to immunity, particularly neutrophil activation. A prediction model of 1500 genes built on the training cohort demonstrated its discriminating value in the validation cohort (accuracy .82) and remained significant in a multivariate model including the neutrophil proportion (P = .002). Expression of FKBP5, a single gene both overexpressed in Cushing’s syndrome and implied in the glucocorticoid receptor signaling, could also predict Cushing’s syndrome (accuracy .76).

Conclusions

Whole blood transcriptome reflects the circulating levels of glucocorticoids. FKBP5 expression could be a nonhormonal marker of Cushing’s syndrome.

Significance

In Cushing’s syndrome, specific hormone assays inform about the level of deviation from normal range. The blood transcriptome signature proposed here is also able to discriminate patients, without any hormone measurements. This direct measurement of the biological impact of glucocorticoids at a tissue level may better reflect the individual consequences of glucocorticoid excess.

Introduction

Cushing’s syndrome (CS) is a condition characterized by chronic cortisol excess related to glucocorticoid treatment (exogenous Cushing’s syndrome) or to endogenous hypercortisolism. The excessive cortisol secretion may be due to either adrenocorticotropic hormone (ACTH)–dependent conditions, most often an ACTH-producing pituitary adenoma (Cushing’s disease), or ACTH-independent causes, commonly a benign adrenal adenoma.1 Chronic exposure to glucocorticoid excess results in specific complications, including cardiovascular and thromboembolic diseases, diabetes mellitus, metabolic syndrome, osteoporosis, and neurocognitive disorders. Numerous comorbidities result in impaired quality of life and increased mortality.2-4

Despite the availability of different hormonal tests for diagnosis and follow-up, the clinical management of these patients remains challenging, since none of the available tools proved to be fully accurate due to the variable pattern of cortisol secretion and the pitfalls of the hormonal immunoassays.5,6 Moreover, the clinical effects of glucocorticoid exposure on peripheral tissues depend not only on the intensity and duration of glucocorticoid excess but also on the peripheral glucocorticoid metabolism and the individual sensitivity to glucocorticoids, not accurately estimated by hormonal parameters. This results in the high interindividual variability frequently reported in Cushing’s syndrome.7,8 Recent studies suggested that the combined assessment of cortisol secretion, cortisone-to-cortisol peripheral activation by the 11β-hydroxysteroid dehydrogenase enzyme, and glucocorticoid receptor sensitizing variants may better estimate the risk to develop each type of complications.9-11

These aspects are crucial mainly for the management of patients with mild Cushing’s syndrome, not clearly characterized by classical features of cortisol excess but consistently associated to an increased risk of morbidities and mortality.12,13 Mild hypercortisolism can occur in different settings. In patients with adrenal incidentalomas, mild hypercortisolism is currently referred to as mild autonomous cortisol secretion (MACS).14 In patients with Cushing’s disease, mild hypercortisolism occurs when hypercortisolism persists/recurs after pituitary surgery or under medical treatment.12,15,16 Irrespective of the origin of cortisol excess, it is still debated whether patients with mild hypercortisolism, as well as those under low-dose systemic or local glucocorticoid therapy, need a close follow-up for cortisol excess–related complications and specific preventive treatments.17-19

In this context, genomic-based studies have recently focused on the identification of blood molecular markers in patients exposed to glucocorticoid excess, aiming to a better individual characterization of these patients. Particularly, DNA methylation profile has been investigated as a potential biological hallmark of glucocorticoid action. Previous studies suggested an association between hypothalamic–pituitary–adrenal axis dysregulation and specific blood DNA methylation profiles, particularly in post-traumatic stress disorders, while recently a dynamic whole blood DNA methylation signature reflecting glucocorticoid excess has been identified.20-22 In both genomic-based and preclinical studies, FKBP5, a gene implicated in glucocorticoid signaling, emerged as potential non hormonal marker of glucocorticoid excess.22-24

The present study completes the previous approaches exploring the impact of glucocorticoids on whole blood transcriptome to better understand the molecular mechanisms of glucocorticoid impregnation. Specifically, through the analysis of whole blood transcriptome profiles from patients with endogenous Cushing’s syndrome, eucortisolism, or adrenal insufficiency, we proposed a transcriptome signature predicting glucocorticoid excess.

Materials and methods

Patients and samples

Fifty-seven blood samples were collected from 43 patients with a confirmed diagnosis of endogenous Cushing’s syndrome, followed in Cochin Hospital (APHP, Paris, France). Diagnostic criteria of Cushing’s syndrome included increased 24-h urinary free cortisol, abnormal cortisol after 1 mg dexamethasone suppression, and altered circadian cortisol rhythm, following consensus guidelines.25

For 14 patients, blood samples were collected before correction of Cushing’s syndrome and at least 3 months after Cushing’s syndrome treatment. At the time of blood sampling, patients were classified as overt Cushing’s syndrome, mild Cushing’s syndrome, eucortisolism, or adrenal insufficiency, depending on clinical and hormonal evaluation. Briefly, overt Cushing’s syndrome patients presented clinical signs and increased 24-h urinary free cortisol (>240 nmol/24 h), increased midnight salivary cortisol (>6 nmol/L), and insufficient cortisol suppression after 1 mg dexamethasone (>50 nmol/L). The mild Cushing’s syndrome cohort included patients with mild hypercortisolism due to either Cushing’s disease or benign adrenal Cushing’s syndrome. The former were patients with persistent or recurrent hypercortisolism after pituitary surgery or during medical treatment; in these patients, the diagnosis of Cushing’s disease was confirmed by the histopathological report consistent with a corticotroph adenoma in the surgically treated patients (6 out of 7) and by the magnetic resonance imaging evidence of a pituitary adenoma in the upfront medically treated patient. Mild hypercortisolism in patients with Cushing’s disease was defined, as previously reported,16,26 by the absence of clinically overt signs of CS and a slight alteration in cortisol secretion, including either increased 24-h urinary free cortisol or increased midnight cortisol or inadequate cortisol suppression after 1 mg of dexamethasone. For mild hypercortisolism due to benign adrenal CS, MACS criteria were used—post-dexamethasone serum cortisol concentration above 50 nmol/L—following recent consensus guidelines.14 The term “mild” was retained for 1 patient with benign adrenal CS who had a borderline dexamethasone suppression test (48 nmol/L) but increased 24-h urinary free cortisol. Eucortisolism was defined as a combination of normalized 24-h urinary free cortisol and of restored cortisol circadian rhythm after either surgery or medical treatment. Adrenal insufficiency was secondary to pituitary surgery for Cushing’s disease. The diagnosis was based on low morning plasma cortisol (<160 nmol/L) and confirmed by the insufficient response to 250 µg corticotropin stimulation test (<500 nmol/L), following the current consensus guidelines.27,28 Detailed hormone values for each sample are provided in Table S1.

Thirty additional samples were collected from patients followed in Hôpital Européen Georges Pompidou Hospital (APHP, Paris, France). These patients presented pheochromocytoma (n = 19) and primary hyperaldosteronism (n = 11; Table S1). The diagnosis was made following the consensus guidelines.29,30

The study was conducted in accordance with the Declaration of Helsinki. Signed informed consent for molecular analysis of blood samples and for access to clinical data was obtained from all patients, and the study was approved by the institutional review board (Comité de Protection de Personnes Ile de France 1, projects 13495 and 13311).

RNA collection and extraction

Whole blood samples were collected into PAXgene Blood RNA Tube (PreAnalytiX, Hombrechtikon, Switzerland), following the manufacturer’s instructions. Total RNA was extracted by using PAXgene Blood RNA Kit, v2 (Qiagen, Hilden, Germany), following the manufacturer’s instructions.

Transcriptome data generation

After RNA extraction, RNA concentrations were obtained using nanodrop or a fluorometric Qubit RNA assay (Life Technologies, Grand Island, NY, USA). The quality of the RNA (RNA integrity number, RIN) was determined on the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) following manufacturer’s instructions.

To construct the libraries, 250 ng of high-quality total RNA sample (RIN > 8) was processed using the Stranded mRNA Prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. Briefly, after purification of poly-A–containing mRNA molecules, mRNA molecules were fragmented and reverse-transcribed using random primers. Replacement of dTTP (deoxythymidine triphosphate) by dUTP (deoxyuridine triphosphate) during the second-strand synthesis permitted to achieve the strand specificity. Addition of a single A base to the cDNA was followed by ligation of Illumina adapters. Libraries were quantified on a Qubit fluorometer (Thermo Fisher Scientific, Waltham, MA, USA), and profiles were assessed using the DNA High Sensitivity LabChip kit on an Agilent Bioanalyzer (Agilent Technologies). Libraries were sequenced on a NovaSeq 6000 System (Illumina), using 51 base-lengths read in a paired-end mode.

Whole blood methylome data

Among the 57 samples included in the transcriptome analysis, 32 were also used for a methylome analysis recently published.22 For each gene, potentially methylated cytosines-referred to as CpGs- in the promoter regions were defined as CpGs belonging to the TSS1500, TSS200, 5′UTR, and first exon regions. CpG methylation levels were analyzed using M-values generated as previously reported.22

Bioinformatics and statistics

Quality control was performed on raw count matrix, with a target of >5 million reads per sample. All samples passed this control. Illumina adapters were removed using Trimmomatic (v0.39) in paired-end mode.31 Reads were aligned to the reference human genome (GRCh37) and counted using STAR (v2.7.9a).32 Counts were aggregated for transcripts corresponding to the same gene, and only genes with a count sum > 0 in all samples were further considered. Globin genes and sex-related genes were also discarded, as previously published.33

Counts were normalized with DESeq2, using rlog transformation34 (v.1.24.0): raw counts were converted to distributed data structures (dds), and lowly expressed genes were removed using a dds > 1 in at least 3 samples as cutoff, obtaining a final dataset of n = 21 116 and n = 57 samples. The 1500 most variable genes were selected to assess the global data structure by principal component analysis (PCA). Overrepresentation analysis of genes most contributing to PCA components was performed using clusterProfiler package35 (v.3.12.0).

From gene counts, blood cell composition was inferred using the online CIBERSORTx tool (Stanford University 2022),36 with the following parameters: B-mode batch correction, disabled quantile normalization, absolute mode, and n = 500 permutations. For each cell types, a score was generated, reflecting the absolute proportion of each cell type in a mixture.

For supervised differential expression analysis, the edgeR package37 (v.3.26.8) was used to read and preprocess the data before analysis: raw counts were converted to counts per million (CPM), and lowly expressed genes were removed using a CPM > 1 in at least 3 samples as cutoff. To remove heteroscedascity of count data, normalized data were transformed using the voom function.38 Differential expression analysis was performed by applying linear modeling using the limma package39 (v. 3.40.6). Differentially expressed genes were selected using a Benjamin–Hochberg adjusted P < .05 and a logFC > 1 as cutoffs. Overrepresentation analysis of differentially expressed genes was performed using the clusterProfiler package. Of note, the edgeR normalization did not significantly modify the normalized expression levels compared to DESeq2 (gene expression correlation r = .9924, P < 2.2e−16).

For predicting glucocorticoid status from transcriptome, we carried out a Ridge-regularized regression (α = 0) using the 1500 most variable genes, with a 4-fold cross-validation, using the glmnet package40 (v. 4.1-1). The optimization of the 1500 gene predictor was performed on a training cohort of 29 samples, randomly selected from the whole cohort and including 18 samples corresponding to overt Cushing’s syndrome and 11 samples corresponding to either eucortisolism or adrenal insufficiency (patients with mild Cushing’s syndrome were excluded). The accuracy of the 1500 gene predictor was assessed on 2 validation cohorts: a first one (n = 17) including overt Cushing’s syndrome, eucortisolism, and adrenal insufficiency samples, and a second one (n = 30) including pheochromocytoma and primary hyperaldosteronism samples. The latter cohort was used to test the specificity of the predictor, given the different nature of catecholamine excess and primary hyperaldosteronism from Cushing’s syndrome.

Quantitative variable comparisons between groups were performed using Student’s t-test for variables following a normal distribution, or Wilcoxon’s test and Kruskal–Wallis test for variables not following a normal distribution. Quantitative variable correlations were performed using Pearson’s or Spearman’s test according to data distribution. Multivariate logistic regression model including the 1500 gene transcriptome predictor and the neutrophil score was used to test the association with glucocorticoid status. All P-values were 2-sided, and the level of significance was set at .05. All tests were computed in R software environment (3.6.0 version).

Results

Cohort presentation

Fifty-seven blood samples were collected from 43 patients (Table 1;  Table S1). Samples were collected at different time points during the disease, thus reflecting different glucocorticoid status: overt Cushing’s syndrome (n = 28), mild Cushing’s syndrome (n = 11), eucortisolism (n = 10), and adrenal insufficiency (n = 8).
Table 1.

Overall cohort presentation and group comparisons.

Glucocorticoid status Whole cohort
median (IQR)		 Training cohort
median (IQR)		 First validation cohort
median (IQR)		 P-valuea
Samples Total 57 29 17
 Overt Cushing’s syndrome N 28 18 10
Urinary free cortisol
nmol/24 h (<240)		 879.5
(419)		 879.5
(307.5)		 904.5
(5469.25)		 .688
Midnight salivary cortisol
nmol/L (<6)		 14
(12)		 11
(8.5)		 17.5
(27.5)		 .034
Plasma cortisol after 1 mg DST
nmol/L (<50)		 232
(288)		 218
(271)		 232
(460)		 .419
 Mild Cushing’s syndrome N 11 NA NA NA
Urinary free cortisol
nmol/24 h (<240)		 273
(100)		 NA NA NA
Midnight salivary cortisol
nmol/L (<6)		 7
(5.5)		 NA NA NA
Plasma cortisol after 1 mg DST
nmol/L (<50)		 56
(19.75)		 NA NA NA
 Eucortisolism N 10 6 4
Urinary free cortisol
nmol/24 h (<240)		 183
(87.75)		 159
(71.25)		 204
(39.25)		 .521
Midnight salivary cortisol
nmol/L (<6)		 4
(1)		 4
(0)		 4.5
(1.25)		 .797
Plasma cortisol after 1 mg DST nmol/L (<50) 35
(11)		 31
(8.5)		 41.5
(6.5)		 .4
 Adrenal insufficiency N 8 5 3
Early morning plasma cortisol nmol/L (160–500) 95.5
(66.75)		 95.5
(28.25)		 98
(98)		 1
Cortisol after ACTH stimulation nmol/L (<500) 405.5
(165.25)		 435.5
(128.75)		 308
(163)		 .142

Cortisol values are provided as median values with interquartile range (IQR). aWilcoxon’s test comparing training and first validation cohorts.

Median age was 48 years (range: 26 to 73), with a female predominance (2.35 to 1). Cushing’s syndrome corresponded either to Cushing’s disease (n = 26) or to benign adrenal Cushing’s syndrome (n = 17). Mild Cushing’s syndrome cohort included 7 patients with Cushing’s disease and 4 patients with a benign adrenal tumor. Hypercortisolism-related complications, including hypertension, diabetes, and osteoporosis, were present in 41 (71.9%), 16 (28.0%), and 10 (17.5%) patients, respectively.

For the purpose of building and evaluating a glucocorticoid status predictor from blood transcriptome, we focused on patients with overt Cushing’s syndrome, eucortisolism, and adrenal insufficiency, excluding patients with mild Cushing’s syndrome (n = 11) due to their uncertain glucocorticoid status. Patients were randomly assigned either to a training (n = 29) or to a first validation cohort (n = 17). A second validation cohort of 30 samples was used to test the specificity of the predictor, including 19 patients with pheochromocytoma and 11 patients with primary hyperaldosteronism (Table S1).

Impact of glucocorticoid level on whole blood transcriptome

Unsupervised PCA on the 1500 most variable genes of the whole cohort (samples = 57) discriminated patients according to their glucocorticoid status (Figure 1A). This discrimination was mainly based on the first principal component (PC1; Table S2). In terms of gene expression signature, PC1 was enriched in signaling pathways related to immune response, particularly those relative to neutrophils’ activation and degranulation (Figure 1B; Table S3). Beyond the immune response, PC1 was also enriched in genes more generally involved in the response to glucocorticoids,41 including FKBP5, PBX1, SPI1, CDK5R1, CXCL8, NR4A1, and TBX21 (Table S2).

Impact of glucocorticoid levels on whole blood transcriptome. (A) Sample projections based on the combination of the first 2 principal components (PC1 and PC2) of unsupervised PCA performed on the 1500 most variable genes of the whole cohort (n = 57). (B) Dot plot of the 10 most GO-enriched signaling pathways in overt Cushing's syndrome, using the PC1 coefficients.

Figure 1.

Impact of glucocorticoid levels on whole blood transcriptome. (A) Sample projections based on the combination of the first 2 principal components (PC1 and PC2) of unsupervised PCA performed on the 1500 most variable genes of the whole cohort (n = 57). (B) Dot plot of the 10 most GO-enriched signaling pathways in overt Cushing’s syndrome, using the PC1 coefficients.

Accordingly, a supervised comparison of Cushing’s syndrome samples (n = 28) against eucortisolism/adrenal insufficiency samples (n = 18) provided similar results (Figure 2; Table S4).

Differentially expressed genes in overt Cushing's syndrome. Volcano plot of the differentially expressed genes (n = 517) in overt Cushing's syndrome (n = 28) versus eucortisolism/adrenal insufficiency (n = 18).

Figure 2.

Differentially expressed genes in overt Cushing’s syndrome. Volcano plot of the differentially expressed genes (n = 517) in overt Cushing’s syndrome (n = 28) versus eucortisolism/adrenal insufficiency (n = 18).

Predicting glucocorticoid status by blood transcriptome

To predict glucocorticoid status by whole blood transcriptome, we performed a cross-validated Ridge-regularized regression, using the 1500 most variable genes. The 1500 transcriptome predictor was optimized in the training cohort to discriminate overt Cushing’s syndrome from eucortisolism/adrenal insufficiency (Table S5). The predictive value of this model was confirmed on both the first and the second validation cohorts (accuracy of .82 and 1, respectively, Table 2; Table S6). Accordingly, samples from the second validation cohort clustered with eucortisolism/adrenal insufficiency samples, as assessed by PCA (Figure S1).
Table 2.

Performance of molecular predictors, based on the whole blood transcriptome signature and on FKBP5 expression level, in discriminating glucocorticoid excess.

Cohort Predictor Accuracy Sensitivity Specificity
First validation cohort Predictor based on 1500 genes .82 .90 .85
Predictor based on FKBP5 .76 .80 .71
Second validation cohort Predictor based on 1500 genes 1 NAa 1
Predictor based on FKBP5 .46 NAa .46

aNot applicable due to the lack of true positives in the second validation cohort.

Mild Cushing’s syndrome samples—excluded from the training and validation cohorts—were classified either as overt Cushing’s syndrome (n = 5/11, 45.5%) or as eucortisolism/adrenal insufficiency (n = 6/11, 54.5%). Of note, the Ridge scores for samples classified as overt Cushing’s syndrome in the mild Cushing’s syndrome cohort was lower than in the training and the first validation cohorts (Wilcoxon, P = .008). The Ridge scores for samples classified as eucortisolism/adrenal insufficiency in the mild Cushing’s syndrome cohort did not differ from the training and first validation cohorts (Wilcoxon, P = .9; Table S6). Accordingly, mild Cushing’s syndrome samples were projected in-between overt Cushing’s syndrome and eucortisolism samples on PCA (Figure 1A).

We then tested whether the glucocorticoid status could be predicted using a single gene. We focused on FKBP5, due to (1) its Ridge regression coefficient being among the highest (Table S5), (2) its potential ability to discriminate Cushing’s syndrome,22,23 and (3) its known implication in glucocorticoid signaling (Figure 3A).42 The prediction accuracy of FKBP5 expression was comparable to the 1500 gene transcriptome predictor in the first validation cohort (accuracy: .76), but lower in the second validation cohort (accuracy: .46; Table 2; Table S7). The other genes involved in the glucocorticoid response found enriched in PC1 were not further analyzed as potential single biomarkers, since their association with Cushing’s syndrome was not confirmed in supervised analysis, and since their Ridge regression coefficients were lower than FKBP5 coefficient (Table S5).

FKBP5 expression related to the different glucocorticoid status. (A) Boxplot of FKBP5 gene expression in the different study groups. *Student's t-test P < .001. (B) Representation of the positive correlation between the 24-h urinary free cortisol and FKBP5 expression (r = .72, P = 2.032e−10). (C) Representation of the inverse correlation between FKBP5 expression and the mean methylation level (M-value) of FKBP5 promoter–associated CpG site (r = −.86, P = 1.312e−10).

Figure 3.

FKBP5 expression related to the different glucocorticoid status. (A) Boxplot of FKBP5 gene expression in the different study groups. *Student’s t-test P < .001. (B) Representation of the positive correlation between the 24-h urinary free cortisol and FKBP5 expression (r = .72, P = 2.032e−10). (C) Representation of the inverse correlation between FKBP5 expression and the mean methylation level (M-value) of FKBP5 promoter–associated CpG site (r = −.86, P = 1.312e−10).

We then tested the contribution of blood cell composition in the 1500 gene transcriptome predictor. We inferred the different blood cell subtype proportions from the whole blood transcriptome of each sample. An expected increase of neutrophil proportion in overt Cushing’s syndrome43,44 was observed (Kruskal–Wallis’s test, P = 8.5e−06; Table S1 and Figure S2). In a multivariate model combining the 1500 gene transcriptome predictor and the neutrophil score, the 1500 gene transcriptome predictor remained significant (P = .002; Table 3).
Table 3.

Multivariate model combining the 1500 gene transcriptome predictor and neutrophil scores.

Variables OR 95% CI P-value
1500-genes predictor 4.37 2.06–15.3 .002
Neutrophils score .48 .02–6.13 .6

Training and first validation cohorts were combined. Two statuses were considered: overt Cushing’s syndrome and eucortisolism/adrenal insufficiency.

Abbreviations: OR, odds ratio; CI, confidential Interval.

Association between blood transcriptome and Cushing’s syndrome complications

The 1500 gene transcriptome predictor was positively correlated to the 24-h urinary free cortisol (r = .78, P = 2.993e−13; Figure S3). The 1500 gene transcriptome predictor was higher in patients with osteoporosis (Wilcoxon, P = 2.9e−05), while the 24-h urinary free cortisol did not show any difference (Wilcoxon, P-value of .17, Figure 4A and B). No difference was observed between patients with and without diabetes (Wilcoxon, P = .31), nor with or without hypertension (Wilcoxon, P = .25), and the 1500 gene transcriptome predictor was not correlated to body mass index (BMI) (P-value = .108).

Potential markers of osteoporosis in overt Cushing's syndrome. Association between osteoporosis and 24-h urinary free cortisol (A), 1500 gene transcriptome predictor (B), and FKBP5 expression (C). For 24-h urinary free cortisol, values are expressed as log10.

Figure 4.

Potential markers of osteoporosis in overt Cushing’s syndrome. Association between osteoporosis and 24-h urinary free cortisol (A), 1500 gene transcriptome predictor (B), and FKBP5 expression (C). For 24-h urinary free cortisol, values are expressed as log10.

Similar findings were obtained with FKBP5 expression level, including a positive correlation with the 24-h urinary free cortisol (r = .72, P = 2.032e−10, Figure 3B), a higher expression in patients with osteoporosis (Wilcoxon, P = 2.9e−05; Figure 4C), no difference in patients with diabetes (Wilcoxon, P = .72) or hypertension (Wilcoxon, P = .4), and no correlation with BMI (P = .657).

Association of whole blood transcriptome with whole blood methylome

For 32 samples with both whole blood transcriptome and methylome22 available (n = 32), a correlation analysis was performed. A majority of genes differentially expressed in overt Cushing’s syndrome showed a negative correlation with CpG sites of their promoter regions (Table S8). FKBP5 was among the genes showing the strongest inverse correlation (r = − .86, P adjusted = 5.94e−09; Figure 3C).

Discussion

In this study, we identified a whole blood transcriptome signature predicting the glucocorticoid excess. This signature, in addition to the hormone assays currently used for diagnosis, could reflect the individual biological impact of glucocorticoids.

We designed a predictor with optimal selection of transcriptome biomarkers able to differentiate overt Cushing’s syndrome from eucortisolism and adrenal insufficiency. The predictive value of such transcriptome predictor was confirmed on 2 validation cohorts. For patients with mild Cushing’s syndrome, our predictor showed intermediate classification, confirming the clinical heterogeneity of this group. Indeed, these intermediate patients indisputably fall in-between patients with overt Cushing’s syndrome and eucortisolism, with some overlap in both groups. Whether such non hormonal biomarkers, directly measuring glucocorticoid action, can be useful for the specific management of these patients remains to be established. The question is important, considering the high prevalence of mild Cushing’s syndrome in the general population and the still-ongoing debate on complications’ surveillance and treatment of choice.45 Here, a proper evaluation of mild Cushing’s syndrome is difficult, due to both the lack of a clear clinical definition and to the size of the cohort, not large enough to assess the existence of a specific signature for these patients, thus representing a limitation of this study. Another open question is whether the markers presented here would have comparable relevance in patients with exogenous Cushing’s syndrome, related to glucocorticoid treatments, especially for the common situation of long-term treatment with low glucocorticoid doses or with “local” glucocorticoid treatments.

Noteworthy, this identified signature derives from whole blood, a mixture of various cell types with potentially cell-dependent impact of glucocorticoids on transcriptome profile. Indeed, glucocorticoids have a direct effect on white blood cell count inducing an increase in the neutrophil proportion.43,44 We inferred white blood cell count from transcriptome profile for each sample, and, as expected, overt Cushing’s syndrome samples were characterized by higher neutrophil score, and, accordingly, genes differentially expressed in this group were enriched in immunity-related pathways, mainly in the activation and degranulation of neutrophils. However, among the genes differentially expressed in overt Cushing’s syndrome, we also identified genes more specifically involved in glucocorticoid response, suggesting differences not only related to immunity. Moreover, we demonstrated that the prediction based on transcriptome signature remained significant after adjustment for neutrophil score and therefore that transcriptome profile does not only reflect blood composition variations.

Whole blood transcriptome analysis is not easily reproducible in clinical practice. Thus, we tried to simplify the marker by focusing on one single gene. FKBP5, as a potential surrogate of the 1500 gene transcriptome signature, was able to differentiate and predict Cushing’s syndrome with a good accuracy. FKBP5 (FK506-binding protein 51) is a co-chaperone of heat shock protein 90 (Hsp90) involved in the regulation of the glucocorticoid receptor activity, maintaining it unbound and inactive in the cytoplasm, thus restricting the nuclear translocation of the cortisol receptor complex.24,46 According to preclinical studies, in the presence of glucocorticoid excess, FKBP5 expression increases at both mRNA and protein levels as an effect of intracellular negative feedback.47 Previous studies also showed that FKBP5 expression is sensitive to exogenous glucocorticoids in healthy volunteers and that FKBP5 levels are higher in patients with Cushing’s syndrome, while decreasing to normal baseline levels after successful surgery.23 It has been also demonstrated that the methylation of FKBP5 is affected by stress and dynamically by glucocorticoid level in patients with endogenous Cushing’s syndrome.42 Of note, in our second validation cohort, including patients with pheochromocytoma and primary aldosteronism, the ability of FKBP5 expression level to properly call the absence of Cushing’s syndrome dropped compared to the first validation cohort, raising concerns about potential limits in specificity. These results also highlight the importance of using larger validation cohorts with a wide variety of conditions before using such a biomarker in routine.

Interestingly, in patients with overt Cushing’s syndrome, beyond the correlation between gene expression and 24-h urinary free cortisol, the variability of gene expression was higher in patients with moderate increase of 24-h urinary free cortisol. This suggests a potential informative role of gene expression markers in patients with moderate cortisol increase. In this line, Guarnotta et al. showed that the level of urinary hypercortisolism does not seem to correlate with Cushing’s syndrome severity and that clinical features and cortisol excess–related comorbidities are more reliable indicators in the assessment of disease severity.48 In our study, the transcriptomic profile could discriminate Cushing’s syndrome patients with and without osteoporosis, although the 24-h urinary free cortisol values did not differ between the two groups. However, these results need additional validation, due to the limited cohort size and because of potential confounders not considered, including pre-existing diagnosis of osteoporosis and other determinants of skeletal fragility. Although this preliminary finding further supports the potential value of gene expression markers in predicting catabolic complications, to which extent these biomarkers are relevant in clinical practice remains to be established and better explored in larger cohorts of patients with moderate Cushing’s syndrome.

The transcriptome profile identified in this study also confirmed the previous findings obtained by analyzing the whole blood methylome in Cushing’s syndrome. The negative correlation between promoter methylation and gene expression strengthens our results and underlines the importance of epigenetic alterations in Cushing’s syndrome.49

In conclusion, we showed that the whole blood transcriptome reflects the circulating levels of glucocorticoids and that FKBP5 expression level could be a single gene non hormonal marker of Cushing’s syndrome.

Acknowledgments

We thank the Genomic platform and the team “Genomic and Signaling of Endocrine Tumors” of Institut Cochin, the French COMETE research network, the European Network for the Study of Adrenal Tumor (ENSAT), and the European Reference Network on Rare Endocrine Conditions (Endo-ERN).

Supplementary material

Supplementary material is available at European Journal of Endocrinology online.

Funding

This project has received funding from the European Union’s Horizon 2020 Research and Innovation program under grant agreement no. 633983 and the Programme Hospitalier de Recherche Clinique “CompliCushing” (PHRC AOM 12-002-0064). This work was also supported by the Programme de Recherche Translationnelle en Cancérologie to the COMETE network (PRT-K COMETE-TACTIC).

Authors’ contribution

Maria Francesca Birtolo (Data curation [equal], Formal analysis [equal], Writing—original draft [equal]), Roberta Armignacco (Conceptualization [equal], Data curation [equal], Formal analysis [equal], Writing—review & editing [equal]), Nesrine Benanteur (Formal analysis [equal]), Bertrand Baussart (Writing—review & editing [equal]), Chiara Villa (Writing—review & editing [equal]), Daniel De Murat (Formal analysis [equal]), Laurence Guignat (Writing—review & editing [equal]), Lionel Groussin (Writing—review & editing [equal]), Rosella Libé (Writing—review & editing [equal]), Maria-Christina Zennaro (Data curation [equal], Writing—review & editing [equal]), Meriama Saidi (Data curation [equal]), Karine Perlemoine (Data curation [equal]), Franck Letourneur (Data curation [equal]), Laurence Amar (Data curation [equal], Writing—review & editing [equal]), Jérôme Bertherat (Writing—review & editing [equal]), Anne Jouinot (Conceptualization [equal], Formal analysis [equal], Writing—original draft [equal]), and Guillaume Assié (Conceptualization [equal], Formal analysis [equal], Funding acquisition [equal], Project administration [equal], Writing—original draft [equal]).

Data availability

Transcriptome data generated and analyzed in this study are available in the EMBL-EBI BioStudies repository (reference number: S-BSST1241).

Author notes

Conflict of interest: G.A. is on the editorial board of EJE. G.A. was not involved in the review or editorial process for this paper, on which he is listed as an author.

© The Author(s) 2024. Published by Oxford University Press on behalf of European Society of Endocrinology.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Filed under: adrenal crisis, Cushing's, Diagnostic Testing | Tagged: , , , , , , | Leave a comment »

« Previous Page — Next Page »