TP53 Mutations in Functional Corticotroph Tumors Are Linked to Invasion and Worse Clinical Outcome

Abstract

Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease.

Introduction

Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7].

Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [1920].

TP53 is the most commonly mutated gene in malignant neoplasms [2122], including brain and neuroendocrine tumors [2324]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [81625,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [1719].

To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features.

Methods

Patients and samples

We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9121317]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months).

Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation.

The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5].

DNA extraction, TP53 amplification and sequencing

Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [912]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [912]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system.

Statistical analysis

Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant.

Results

Analysis of TP53 nucleotide variants

We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison.

We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing.

Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33].

Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors

Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9).

The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3).

Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup.

Clinical presentation of patients with TP53 mutant tumors

Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4).

Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months).

We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2).

The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127).

Fig. 1

figure 1

Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis

Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B).

No statistical association was found between clinical data and any of the 8 common variants.

Characteristics of TP53 mutant corticotroph tumors

All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018).

Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4).

Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type).

We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells.

Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4).

Discussion

Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [81819].

Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [911131836]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [1719].

Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course.

Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [2938]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19].

A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation.

In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [1920]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development.

A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43].

In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [4445]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely.

Conclusion

Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome.

Availability of data and materials

The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request.

Abbreviations

CD:
Cushing’s disease
BADX:
Bilateral adrenalectomy
CTP-BADX/NS:
Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome
ACTH:
Adrenocorticotropic hormone
SD:
Standard deviation
IQR:
Interquartile range
HR:
Hazard ratio

References

  1. Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86

    PubMed PubMed Central Article Google Scholar

  2. McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276

    CAS PubMed Article Google Scholar

  3. Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875

    PubMed Article Google Scholar

  4. Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292

    PubMed Article CAS Google Scholar

  5. Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16

    CAS PubMed PubMed Central Article Google Scholar

  6. Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537

    Article Google Scholar

  7. Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75

    CAS PubMed Article Google Scholar

  8. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38

    CAS PubMed Article Google Scholar

  9. Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004

    PubMed PubMed Central Article Google Scholar

  10. Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317

    CAS PubMed PubMed Central Article Google Scholar

  11. Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226

    CAS PubMed Article Google Scholar

  12. Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65

    Article Google Scholar

  13. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458

    CAS Article Google Scholar

  14. Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851

    CAS PubMed Article Google Scholar

  15. Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259

    CAS PubMed PubMed Central Article Google Scholar

  16. Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171

    PubMed PubMed Central Article CAS Google Scholar

  17. Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283

    CAS PubMed PubMed Central Article Google Scholar

  18. Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5

    CAS PubMed Article Google Scholar

  19. Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842

    PubMed Article Google Scholar

  20. Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194

    PubMed Article Google Scholar

  21. Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93

    Article CAS Google Scholar

  22. Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876

    CAS PubMed Article Google Scholar

  23. Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508

    CAS PubMed PubMed Central Article Google Scholar

  24. van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612

    PubMed PubMed Central Article CAS Google Scholar

  25. Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55

    CAS PubMed Google Scholar

  26. Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814

    CAS Article Google Scholar

  27. Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222

    CAS PubMed Article Google Scholar

  28. Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657

    Article Google Scholar

  29. Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135

    PubMed Article Google Scholar

  30. Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/

  31. Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443

    CAS PubMed PubMed Central Article Google Scholar

  32. Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947

    CAS PubMed Article Google Scholar

  33. Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429

    CAS PubMed PubMed Central Article Google Scholar

  34. Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981

    CAS PubMed Article Google Scholar

  35. Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097

    CAS PubMed Google Scholar

  36. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129

    CAS PubMed Article Google Scholar

  37. Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24

    CAS PubMed Article Google Scholar

  38. Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70

    CAS PubMed Article Google Scholar

  39. Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272

    CAS PubMed Article Google Scholar

  40. Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16

    Google Scholar

  41. Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404

    PubMed Article Google Scholar

  42. Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87

    CAS PubMed Article Google Scholar

  43. Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8

    Article Google Scholar

  44. Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157

    CAS PubMed Article Google Scholar

  45. Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492

    CAS PubMed PubMed Central Article Google Scholar

  46. Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416

    CAS PubMed PubMed Central Article Google Scholar

  47. Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365

    CAS PubMed Article Google Scholar

  48. Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243

    CAS PubMed PubMed Central Article Google Scholar

  49. Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90

    CAS PubMed PubMed Central Article Google Scholar

  50. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861

    CAS PubMed PubMed Central Article Google Scholar

Download references

Funding

Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG).

Author information

Authors and Affiliations

  1. Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyLuis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou
  2. Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, GermanySigrun Roeber & Jochen Herms
  3. Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, FranceGuillaume Assié
  4. Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, FranceGuillaume Assié
  5. Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, GermanyTimo Deutschbein & Martin Fassnacht
  6. Medicover Oldenburg MVZ, Oldenburg, GermanyTimo Deutschbein
  7. Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, BrazilMonica R. Gadelha
  8. Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The NetherlandsAd R. Hermus
  9. Medicover Neuroendocrinology, Munich, GermanyGünter K. Stalla
  10. Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, LuxembourgMaria A. Tichomirowa
  11. Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, GermanyRoman Rotermund & Jörg Flitsch
  12. Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, GermanyMichael Buchfelder
  13. Department of Neurosurgery, University of Tübingen, Tübingen, GermanyIsabella Nasi-Kordhishti & Jürgen Honegger
  14. Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyJun Thorsteinsdottir
  15. Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, GermanyWolfgang Saeger

Contributions

LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft.

Corresponding authors

Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou.

Ethics declarations

Ethics approval and consent to participate

The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome

Skip to file navigationSkip to generic navigation
1
Supplementary Table 1
. Description of study cohort.
Variable
mean/median
SD/IQR
Total n
Age at diagnosis (years), mean ±SD, [total n]
42
±15.2
86
Sex (female), n (%), [total n]
62
(72%)
86
BMI (kg/m2), mean ±SD, [total n]
28.9
±6.3
74
Disease presentation, n (%), [total n]
86
Cushing
66
(77%)
Nelson
20
(23%)
Number of prior pituitary surgeries, n (%), [total n]
80
0
50
(63%)
1
23
(29%)
≥2
7
(9%)
Total
number of pituitary surgeries, n (%), [total n]
82
1
46
(56%)
2
23
(28%)
≥3
13
(16%)
Complete tumor resection, n (%), [total n]
32
(60%)
53
Postoperative remission, n (%), [total n]
46
(59%)
78
Postoperative tumor control, n (%), [total
n]
34
(60%)
57
Radiation therapy, n (%), [total n]
24
(34%)
70
Radiation therapy before sample collection, n (%), [total n]
7
(13%)
53
Bilateral adrenalectomy, n (%), [total n]
23
(27%)
86
Pharmacological treatments
a
,
n (%), [total n]
18
(42%)
43
Preoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
98
(570.4)
75
Serum cortisol (
μ
g/dl), median (range)
29.1
(168.6)
50
24h
urinary free cortisol (
μ
g/24h), median (range)
432.5
(598.3)
30
Serum cortisol after low
dose DST (
μ
g/dl),
median (IQR)
20
(20.7)
46
Postoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
20
(107.6)
57
Serum cortisol nadir (
μ
g/dl), median (range)
8.8
(19.4)
58
Tumo
r size (mm), median (IQR), [total n]
15
(13.0)
85
Microadenoma
19
(22%)
Macroadenoma
66
(78%)
Granulation, n (%), [total n]
30
Sparsely
9
(30%)
Densely
21
(70%)
Ki67 index, median (IQR), [total n]
2.0
(3.8)
36
Ki67 index ≥3%, n (%)
14
(39%)
36
p53 positivity, median (IQR), [total n]
1
(26.5)
9
Invasion, n (%),
[total n]
34
(53%)
64
Hardy grade, n (%), [total n]
61
1
13
(21%)
2
22
(36%)
3
18
(30%)
4
8
(13%)
Knosp grade, n (%), [total n]
35
0
5
(14%)
1
12
(34%)
2
3
(9%)
3
7
(20%)
4
8
(7%)
Disease
specific death, n (%), [total
n]
5
(9%)
58
a
Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide
(n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1
pharmacological agent.
2
Supplementary Table 2
. Primers used for
TP53
amplification and Sanger sequencing.
Primer
Sequence
DNA source
TP53
1
5′
TCTCATGCTGGATCCCCACT
3′
FF, FFPE
TP53
1rv
5′
GACCAGGTCCTCAGCC
3′
FFPE
TP53
2fw
5′
GGGGGCTGAGGACCTGGT
3′
FFPE
TP53
2rv
5′
ATACGGCCAGGCATTGAAGT
3′
FFPE
TP53
2
5′
AGAGGAATCCCAAAGTTCCA
3′
FF
TP53
3
5′
GTGCCCTGACTTTCAACTC
3′
FF, FFPE
TP53
3rv
5′
GGCAACCAGCCCTGTC
3′
FFPE
TP53
4fw
5′
GCCTCTGATTCCTCACTGAT
3′
FFPE
TP53
4
5′
CAGGAGAAAGCCCCCCTACT
3′
FF, FFPE
TP53
5
5′
CTTGCCACAGGTCTCCCCAA
3′
FF, FFPE
TP53
6
5′
AGGGGTCAGAGGCAAGCAGA
3′
FF, FFPE
TP53
7
5′
TAGGACCTGATTTCCTTA
3′
FF, FFPE
TP53
7rv
5′
AGTGAATCTGAGGCATAAC
3′
FFPE
TP53
7Bfw
5′
TGGAGGAGACCAAGGGTG
3′
FFPE
TP53
7Brv
5′
CGGCATTTTGAGTGTTAGAC
3′
FFPE
TP53
8
5′
TAAGCTATGATGTTCCTTAG
3′
FF, FFPE
TP53
8rv
5′
GACTGTTTTACCTGCAATTG
3′
FFPE
TP53
9
5′
CAATTGTAACTTGAACCATC
3′
FF, FFPE
TP53
10
5′
GGATGAGAATGGAATCCTAT
3′
FF, FFPE
TP53
11
5′
TCTCACTCATGTGATGTCATC
3′
FF, FFPE
TP53
12
5′
CACACCTATTGCAAGCAAGG
3′
FF, FFPE
FF, fresh frozen; FFPE, formalin
fixed
paraffin embedded.

Additional file 1

Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS.

 

Osilodrostat normalizes urinary free cortisol in Cushing’s disease for most at 72 weeks

More than 80% of adults with Cushing’s disease receiving osilodrostat had normalized mean urinary free cortisol levels at 72 weeks of treatment, according to findings from the LINC 3 study extension.

“Cushing’s disease is a chronic condition, and many patients require prolonged pharmacological treatment. Therefore, evaluating long-term efficacy and safety of drug therapies in clinical trials is essential,” Maria Fleseriu, MD, FACE, professor of medicine and neurological surgery and director of the Pituitary Center at Oregon Health & Science University in Portland and a Healio | Endocrine Today co-editor, told Healio. “Our findings build on the positive results of the LINC 3 study core phase, and it was reassuring to see that continued treatment with osilodrostat for over 72 weeks provided long-term normalization of cortisol levels. Furthermore, continued treatment with osilodrostat also led to sustained improvements in clinical signs and physical manifestations of hypercortisolism, as well as health-related quality of life, which are all important factors in the management of these patients.”

Fleseriu and colleagues enrolled 106 adults with Cushing’s disease who were responders to osilodrostat (Isturisa, Recordati) at 48 weeks during the LINC 3 core study to enter the extension phase of the trial. Participants continued to receive open-label osilodrostat until 72 weeks or treatment discontinuation. Mean urinary free cortisol was collected every 12 weeks. Physical manifestations of hypercortisolism were rated at 48 and 72 weeks. Participants completed the Cushing’s Quality of Life questionnaire and Beck Depression Inventory II at 48 and 72 weeks. Adults were deemed to have completely responded to treatment if mean urinary free cortisol was less than the upper limit of normal and partially responded to treatment if mean urinary free cortisol was above the upper limit of normal but decreased more than 50% from baseline.

The findings were published in the European Journal of Endocrinology.

Of the 106 participants in the extension study, 98 completed 72 weeks of treatment. At 72 weeks, 81.1% of participants were complete responders to treatment, and reductions in mean urinary free cortisol from the core phase were maintained during the extension.

Improvements in most cardiovascular and metabolic-related parameters from the core study were maintained or improved in the extension phase. The cohort also had increases in quality of life score and improvements in Beck Depression Inventory II scores.

The proportion of participants with improvements in physical manifestation of hypercortisolism were maintained or improved in all areas at 72 weeks. For hirsutism in women, 86.4% had an improved or stable severe score at 72 weeks. Improved scores were observed in participants with mild, moderate and severe physical manifestations at baseline with few adults experiencing worse manifestations at the end of the extension study.

There were no new safety signals reported in the extension study. Of the extension study participants, 11.3% discontinued osilodrostat due to adverse events, a similar percentage to the 10.9% discontinuation rate during the core phase of the study.

Several hormone concentrations, including mean adrenocorticotropic hormone, 11-deoxycortisol and plasma aldosterone, stabilized during the extension phase after changes were observed in the core study compared with baseline. Mean testosterone in women decreased from 2.6 nmol/L at 48 weeks to 2.1 nmol/L at 72 weeks. There were no changes observed in mean testosterone levels for men.

“Patients should be regularly monitored and osilodrostat dose titrated as necessary, alongside adjustment of concomitant medications, to optimize outcomes,” the researchers wrote. “Taken together, these findings support osilodrostat as an effective and well-tolerated long-term treatment option for patients with Cushing’s disease.”

For more information:

Maria Fleseriu, MD, FACE, can be reached at fleseriu@ohsu.edu.

From https://www.healio.com/news/endocrinology/20220914/osilodrostat-normalizes-urinary-free-cortisol-in-cushings-disease-for-most-at-72-weeks

Persistent vs Recurrent Cushing’s Disease Diagnosed Four Weeks Postpartum

Abstract

Background. Cushing’s disease (CD) recurrence in pregnancy is thought to be associated with estradiol fluctuations during gestation. CD recurrence in the immediate postpartum period in a patient with a documented dormant disease during pregnancy has never been reported. Case Report. A 30-year-old woman with CD had improvement of her symptoms after transsphenoidal resection (TSA) of her pituitary lesion. She conceived unexpectedly 3 months postsurgery and had no symptoms or biochemical evidence of recurrence during pregnancy. After delivering a healthy boy, she developed CD 4 weeks postpartum and underwent a repeat TSA. Despite repeat TSA, she continued to have elevated cortisol levels that were not well controlled with medical management. She eventually had a bilateral adrenalectomy. Discussion. CD recurrence may be higher in the peripartum period, but the link between pregnancy and CD recurrence and/or persistence is not well studied. Potential mechanisms of CD recurrence in the postpartum period are discussed below. Conclusion. We describe the first report of recurrent CD that was quiescent during pregnancy and diagnosed in the immediate postpartum period. Understanding the risk and mechanisms of CD recurrence in pregnancy allows us to counsel these otherwise healthy, reproductive-age women in the context of additional family planning.

1. Introduction

Despite a relatively high prevalence of Cushing’s syndrome (CS) in women of reproductive age, it is rare for pregnancy to occur in patients with active disease [1]. Hypercortisolism leads to infertility through impairment of the hypothalamic gonadal axis. Additionally, while Cushing’s disease (CD) is the leading etiology of CS in nonpregnant adults, it is less common in pregnancy, accounting for only 30–40% of the CS cases in pregnant women [2]. It has been suggested that in CD there is hypersecretion of both cortisol and androgens, impairing fertility to a greater extent, while in CS of an adrenal origin, hypersecretion is almost exclusively of cortisol with minimal androgen production [3]. Regardless of the cause, active CS in pregnancy is associated with a higher maternal and fetal morbidity, hence, prompt diagnosis and treatment are essential.

Pregnancy is considered a physiological state of hypercortisolism, and the peripartum period is a common time for women to develop CD [34]. A recent study reported that 27% of reproductive-age women with CD had onset associated with pregnancy [4]. The high rate of pregnancy-associated CD suggests that the stress of pregnancy and peripartum pituitary corticotroph hyperstimulation may promote or accelerate pituitary tumorigenesis [46]. During pregnancy, the circulating levels of corticotropin-releasing hormone (CRH) in the plasma increase exponentially as a result of CRH production by the placenta, decidua, and fetal membranes rather than by the hypothalamus. Unbound circulating placental CRH stimulates pituitary ACTH secretion and causes maternal plasma ACTH levels to rise [4]. A review of the literature reveals many studies of CD onset during the peripartum period, but CD recurrence in the peripartum period has only been reported a handful of times [710]. Of these, most cases recurred during pregnancy. CD recurrence in the immediate postpartum period has only been reported once [7]. Below, we report for the first time a case of CD recurrence that occurred 4 weeks postpartum, with a documented dormant disease throughout pregnancy.

2. Case Presentation

A 30-year-old woman initially presented with prediabetes, weight gain, dorsal hump, abdominal striae, depression, lower extremity weakness, and oligomenorrhea with a recent miscarriage 10 months ago. Diagnostic tests were consistent with CD. Results included the following: three elevated midnight salivary cortisols: 0.33, 1.38, and 1.10 μg/dL (<0.010–0.090); 1 mg dexamethasone suppression test (DST) with cortisol 14 μg/dL (<1.8); elevated 24 hr urine cortisol (UFC) measuring 825 μg/24 hr (6–42); ACTH 35 pg/mL (7.2–63.3). MRI of the pituitary gland revealed a left 4 mm focal lesion (Figure 1(a)). After transsphenoidal resection (TSA), day 1, 2, and 3 morning cortisol values were 18, 5, and 2 μg/dL, respectively. Pathology did not show a definitive pituitary neoplasm. She was rapidly titrated off hydrocortisone (HC) by six weeks postresection. Her symptoms steadily improved, including improved energy levels, improved mood, and resolution of striae. She resumed normal menses and conceived unexpectedly around 3 months post-TSA. Hormonal evaluation completed a few weeks prior to her pregnancy indicated no recurrence: morning ACTH level, 27.8 pg/mL; UFC, 5 μg/24 hr; midnight salivary cortisol, 0.085 and 0.014 μg/dL. Her postop MRI at that time did not show a definitive adenoma (Figure 1(b)). During pregnancy, she had a normal oral glucose tolerance test at 20 weeks and no other sequela of CD. Every 8 weeks, she had 24-hour urine cortisol measurements. Of these, the highest was 93 μg/24 hr at 17 weeks and none were in the range of CD (Table 1). Towards the end of her 2nd trimester, she started to complain of severe fatigue. Given her low 24 hr urine cortisol level of 15 μg/24 hr at 36 weeks gestation, she was started on HC. She underwent a cesarean section at 40 weeks gestation for oligohydramnios and she subsequently delivered a healthy baby boy weighing 7.6 pounds with APGAR scores at 1 and 5 minutes being 9 and 9. HC was discontinued immediately after delivery. Around four weeks postpartum she developed symptoms suggestive for CD. Diagnostic tests showed an elevated midnight salivary cortisol of 0.206 and 0.723 μg/dL, and 24-hour urine cortisol of 400 μg/24 hr. MRI pituitary illustrated a 3 mm adenoma in the left posterior region of the gland, which was thought to represent a recurrent tumor (Figure 1(c)). A discrete lesion was found and resected during repeat TSA. Pathology confirmed corticotroph adenoma with MIB-1 < 3%. On postoperative days 1, 2, and 3, the cortisol levels were 26, 10, and 2.8 μg/dL, respectively. She was tapered off HC within one month. Her symptoms improved only slightly and she continued to report weight gain, muscle weakness, and fatigue. Three months after repeat TSA, biochemical data showed 1 out of 2 midnight salivary cortisols elevated at 0.124 μg/dL and elevated urine cortisol of 76 μg/24 hr. MRI pituitary demonstrated a 3 × 5 mm left enhancement, concerning for residual or enlarged persistent tumor. Subsequent lab work continued to show a biochemical excess of cortisol, and the patient was started on metyrapone but reported no significant improvement of her symptoms and only mild improvement of excess cortisol. After a multidisciplinary discussion, the patient made the decision to pursue bilateral adrenalectomy, as she refused further medical management and opted against radiation given the risk of hypogonadism.

(a)
(a)
(b)
(b)
(c)
(c)
(a)
(a)(b)
(b)(c)
(c)
Figure 1 
(a) Initial: MRI pituitary with and without contrast showing a coronal T1 postcontrast image immediately prior to our patient’s pituitary surgery. The red arrow points to a 3 × 3 × 5 mm hypoenhancing focus representing a pituitary microadenoma. (b) Postsurgical: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained three months after transsphenoidal pituitary surgery. The red arrow shows that a hypoenhancing focus is no longer seen and has been resected. (c) Postpartum: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained four weeks postpartum. The red arrow points to a 3 mm relatively hypoenhancing lesion representing a recurrent pituitary adenoma.
Table 1 
24-hour urine-free cortisol measurements collected approximately every 8 weeks throughout our patient’s pregnancy.

3. Discussion

The symptoms and signs of Cushing’s syndrome overlap with those seen in normal pregnancy, making diagnosis of Cushing’s disease during pregnancy challenging [1]. Potential mechanisms of gestational hypercortisolemia include increased systemic cortisol resistance during pregnancy, decreased sensitivity of plasma ACTH to negative feedback causing an altered pituitary ACTH setpoint, and noncircadian secretion of placental CRH during pregnancy causing stimulation of the maternal HPA axis [5]. Consequently, both urinary excretion of cortisol and late-night salivary cortisol undergo a gradual increase during normal pregnancy, beginning at the 11th week of gestation [2]. Cushing’s disease is suggested by 24-hour urinary-free cortisol levels greater than 3-fold of the upper limit of normal [2]. It has also been suggested that nocturnal salivary cortisol be used to diagnose Cushing’s disease by using the following specific trimester thresholds: first trimester, 0.25 μg/dL; second trimester, 0.26 μg/dL; third trimester 0.33, μg/dL [11]. By these criteria, our patient had no signs or biochemical evidence of CD during pregnancy but developed CD 4 weeks postpartum.

A recent study by Tang et al. proposed that there may be a higher risk of developing CD in the peripartum period, but did not test for CD during pregnancy, and therefore was not able to definitively say exactly when CD onset occurred in relation to pregnancy [4]. Previous literature suggests that there may be a higher risk of ACTH-secreting pituitary adenomas following pregnancy as there is a significant surge of ACTH and cortisol hormones at the time of labor. This increased stimulation of the pituitary corticotrophs in the immediate postpartum period may promote tumorigenesis [6]. It has also been suggested that the hormonal milieu during pregnancy may cause accelerated growth of otherwise dormant or small slow-growing pituitary corticotroph adenomas [45]. However, the underlying mechanisms of CD development in the postpartum period have yet to be clarified. We highlight the need for more research to investigate not only the development, but also the risk of CD recurrence in the postpartum period. Such research would be helpful for family planning.

4. Conclusion

Hypothalamic-pituitary-adrenal axis activation during pregnancy and the immediate postpartum period may result in higher rates of CD recurrence in the postpartum period, as seen in our patient. In general, more testing for CS in all reproductive-age females with symptoms suggesting CS, especially during and after childbirth, is necessary. Such testing can also help us determine when CD occurred in relation to pregnancy, so that we can further understand the link between pregnancy and CD occurrence, recurrence, and/or persistence. Learning about the potential mechanisms of CD development and recurrence in pregnancy will help us to counsel these reproductive-age women who desire pregnancy.

Abbreviations

CD: Cushing’s disease
TSA: Transsphenoidal resection
DST: Dexamethasone suppression test
ACTH: Adrenocorticotropic hormone
MRI: Magnetic-resonance imaging
HC: Hydrocortisone
CTH: Corticotroph-releasing hormone
HPA: Hypothalamic-pituitary-adrenal.

Data Availability

The data used to support the findings of this study are included within the article.

Additional Points

Note. Peripartum refers to the period immediately before, during, or after pregnancy and postpartum refers to any period after pregnancy up until 1 year postdelivery.

Disclosure

This case report is a follow up to an abstract that was presented in ENDO 2020 Abstracts. https://doi.org/10.1210/jendso/bvaa046.2128.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

The authors thank Dr. Puneet Pawha for his help in reviewing MRI images and his suggestions.

References

  1. J. R. Lindsay and L. K. Nieman, “The hypothalamic-pituitary-adrenal axis in pregnancy: challenges in disease detection and treatment,” Endocrine Reviews, vol. 26, no. 6, pp. 775–799, 2005.View at: Publisher Site | Google Scholar
  2. W. Huang, M. E. Molitch, and M. E. Molitch, “Pituitary tumors in pregnancy,” Endocrinology and Metabolism Clinics of North America, vol. 48, no. 3, pp. 569–581, 2019.View at: Publisher Site | Google Scholar
  3. M. C. Machado, M. C. B. V. Fragoso, M. D. Bronstein, and M. Delano, “Pregnancy in patients with cushing’s syndrome,” Endocrinology and Metabolism Clinics of North America, vol. 47, no. 2, pp. 441–449, 2018.View at: Publisher Site | Google Scholar
  4. K. Tang, L. Lu, M. Feng et al., “The incidence of pregnancy-associated Cushing’s disease and its relation to pregnancy: a retrospective study,” Frontiers in Endocrinology, vol. 11, p. 305, 2020.View at: Publisher Site | Google Scholar
  5. S. K. Palejwala, A. R. Conger, A. A. Eisenberg et al., “Pregnancy-associated Cushing’s disease? an exploratory retrospective study,” Pituitary, vol. 21, no. 6, pp. 584–592, 2018.View at: Publisher Site | Google Scholar
  6. G. Mastorakos and I. Ilias, “Maternal and fetal hypothalamic-pituitary-adrenal axes during pregnancy and postpartum,” Annals of the New York Academy of Sciences, vol. 997, no. 1, pp. 136–149, 2003.View at: Publisher Site | Google Scholar
  7. G. F. Yaylali, F. Akin, E. Yerlikaya, S. Topsakal, and D. Herek, “Cushing’s disease recurrence after pregnancy,” Endocrine Abstracts, vol. 32, 2013.View at: Publisher Site | Google Scholar
  8. C. V. L. Fellipe, R. Muniz, L. Stefanello, N. M. Massucati, and L. Warszawski, “Cushing’s disease recurrence during peripartum period: a case report,” Endocrine Abstracts, vol. 70, 2020.View at: Publisher Site | Google Scholar
  9. P. Recinos, M. Abbassy, V. Kshettry et al., “Surgical management of recurrent Cushing’s disease in pregnancy: a case report,” Surgical Neurology International, vol. 6, no. 26, pp. S640–S645, 2015.View at: Publisher Site | Google Scholar
  10. A. Nakhleh, L. Saiegh, M. Reut, M. S. Ahmad, I. W. Pearl, and C. Shechner, “Cabergoline treatment for recurrent Cushing’s disease during pregnancy,” Hormones, vol. 15, no. 3, pp. 453–458, 2016.View at: Publisher Site | Google Scholar
  11. L. M. L. Lopes, R. P. V. Francisco, M. A. K. Galletta, and M. D. Bronstein, “Determination of nighttime salivary cortisol during pregnancy: comparison with values in non-pregnancy and cushing’s disease,” Pituitary, vol. 19, no. 1, pp. 30–38, 2015.View at: Publisher Site | Google Scholar

Copyright © 2022 Leena Shah et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

From https://www.hindawi.com/journals/crie/2022/9236711/

Ectopic Adrenocorticotropic Hormone-Secreting Pituitary Adenoma in the Clivus Region: A Case Report

Yan Zhang, Danrong Wu, Ruoqiu Wang, Min Luo, Dong Wang, Kaiyue Wang, Yi Ai, Li Zheng, Qiao Zhang, Lixin Shi

Department of Endocrinology and Metabolism, Guiqian International General Hospital, Guiyang, People’s Republic of China

Correspondence: Qiao Zhang; Lixin Shi, Department of Endocrinology and Metabolism, Guiqian International General Hospital, Guiyang, People’s Republic of China, Tel/Fax +86 851-86277666, Email endocrine_zq@126.com; slx1962@medmail.com.cn

Abstract: Ectopic pituitary adenoma (EPA) is a pituitary adenoma unrelated to the intrasellar component and is an extremely rare disease. EPA resembles typical pituitary adenomas in morphology, immunohistochemistry, and hormonal activity, and it may present with specific or non-specific endocrine manifestations. Here, we report a rare case of ectopic adrenocorticotropic hormone (ACTH)-secreting pituitary adenoma in the clival region. Only three patients with ACTH-secreting pituitary adenomas occurring in the clivus have been previously reported, and the present case was diagnosed as a clivus-ectopic ACTH-secreting pituitary macroadenoma. Thus, in addition to the more common organs, such as the lung, thymus, and pancreas, in the diagnosis of ectopic ACTH syndrome, special attention should be paid to the extremely rare ectopic ACTH-secreting pituitary adenoma of the clivus region.

Keywords: ectopic pituitary adenoma, Cushing’s syndrome, clivus, adrenocorticotropic hormone, endocrine

Introduction

The diagnosis of Cushing’s syndrome (CS), particularly its localization diagnosis, has always been a challenge in clinical practice.1,2 Endogenous CS can be divided into adrenocorticotropic hormone (ACTH)-dependent and non-ACTH dependent with the former accounting for 70% of CS cases. Ectopic ACTH syndrome accounts for 5–10% of CS cases, and its lesions are mainly located in the lungs, thymus, pancreas, and the thyroid gland.3 Finding such lesions in non-pituitary intracranial regions is extremely rare, and ectopic ACTH in the clivus region is even rarer. To date, less than 60 cases of ectopic ACTH-secreting pituitary adenomas have been reported,4 and determining their localization is a formidable challenge in CS diagnosis. It is difficult to make an accurate and prompt diagnosis of ectopic ACTH-secreting pituitary adenoma caused by hypercortisolism based on its clinical manifestation, routine laboratory tests, and radiologic examinations.1,4 Ectopic pituitary adenomas (EPAs) are mainly concentrated in the sphenoid sinus, suprasellar region, and cavernous sinus, and rare regions include the clivus, ethmoid sinus, and nasal cavity.5 A literature review showed that only three cases of primary EPA in the clivus region have been reported worldwide.6–8 Recently, we diagnosed a patient with ectopic ACTH-secreting pituitary macroadenoma in the clivus region that was confirmed by surgery and immunohistochemistry.

Case Presentation

A 53-year-old female patient sought medical attention at our hospital for hypertension, headache, and dizziness with a blood pressure as high as 180/100 mmHg. Her medical history showed that she had developed similar symptoms 2 years ago. At that time, she had hypertension (180/100 mmHg), headache, and dizziness, and she was treated with amlodipine (5 mg per day), benazepril hydrochloride (10 mg per day), and metoprolol tartrate (50 mg per day). The patient was not hospitalized for treatment and did not undergo systemic examination. Three months before admission, the patient had a thoracic vertebrae fracture caused by moving heavy objects. One month before admission, she had a bilateral rib fracture due to falling on flat ground. Her physical examination results were as follows: blood pressure, 160/85 mmHg; height, 147 cm; weight, 55.2 kg; and body mass index (BMI), 25.54 kg/m2. In the physical examination, moon facies, buffalo hump, concentric obesity, facial plethora, and large patches of ecchymosis at the blood sampling site were observed. Purple striae were absent below the axilla, abdomen, and limbs. Her hematological examination results were as follows: cortisol (COR) rhythm with 33.52 µg/dL (reference range: 4.26–24.85) at 8:00 AM, 34.3 µg/dL at 4:00 PM, and 33.14 µg/dL at 12:00 AM; 1 mg dexamethasone overnight suppression test indicated 22.21 µg/dL COR at 8:00 AM; 24 h urine COR was 962.16 µg/24 h (reference range: 50–437 µg/24 h); 8:00 AM ACTH at two different times was 74 pg/mL and 90.8 pg/mL (reference range: <46); high-dose dexamethasone suppression test (HDDST) was 21.44 µg/dL COR (serum COR level was not suppressed by more than 50%); serum potassium was 3.38 mmol/L (reference range: 3.5–5.5); insulin-like growth factor-1 (IGF-1) was 106.6 ng/mL (reference range: 84–236); serum luteinizing hormone (LH) was <0.07 IU/L (reference range: 1.9–12.5); serum follicle stimulating hormone (FSH) was 0.37 IU/L (reference range: 2.5–10.2); prolactin (PRL), testosterone, progesterone, and estradiol test results were normal; FT4 was 8.25 pmol/L (reference range: 10.44–24.38); TSH was 1.116 mIU/L (reference range: 0.55–4.78); oral glucose tolerance test (OGTT) indicated that fasting blood glucose was 6.3 mmol/L and 2-h blood glucose was 18.72 mmol/L; and glycated hemoglobin (HbA1c) was 7.1%. A bone mineral density test suggested osteoporosis (dual energy X-rays: L1-L4 T values were −3.4).

Magnetic resonance (MR) scans were performed using a SIGNA Pioneer 3.0T (GE Healthcare, Waukesha, WI, USA), and computed tomography (CT) scans were performed using a 256 slice CT scanner (Revolution CT; GE Healthcare, Waukesha, WI, USA). The enhanced MR scan of the sellar lesion showed a soft tissue mass with abnormal signals in the occipital bone clivus. T1WI showed an isointense signal, and T2WI showed an isointense/slightly hyperintense signal in a large area of approximately 30 mm × 46 mm. The lesion extended anteriorly to completely fill the entire sphenoidal sinus, and it was in a close proximity to the right internal carotid arteries. Significant invasion, liquefaction, and necrosis were not observed in the bilateral cavernous sinuses. Pituitary gland morphology was normal with a superoinferior diameter of 3.14 mm, and the pituitary gland was located in the center. An occipital bone clival space-occupying lesion was considered with a tendency of low malignancy and a possibility of chordoma (Figure 1A–C). Non-enhanced high-resolution CT scans of the nasal sinuses showed osteolytic destruction, and a soft tissue mass was observed in the occipital bone clivus. The mass had a large area of 20 mm × 30 mm × 46 mm (Figure 1D). Enhanced CT of the adrenals showed bilateral adrenal gland hyperplasia.

Figure 1 (A) MR T1+T2 scan (transverse view). MR T1 scan (left) shows the soft tissue mass of the occipital clivus (white arrow), and MR T2 scan (right) shows that the right internal carotid artery, cavernous sinus, and tumor are within close proximity to each other (white arrow). (B) MR T1 enhanced scan (sagittal view) shows clear demarcation between normal pituitary gland and mass (white arrow). (C) MR T2 scan (sagittal view) shows that the pituitary fossa is normally present (white arrow). (D) CT (sagittal view) shows bony destruction of dorsum sellae, clivus, and sphenoid sinus by mass (white arrow).

Bilateral inferior petrosal sinus sampling (IPSS) combined with a desmopressin stimulation test had the following results: baseline ACTH at left inferior petrosal sinus/periphery (IPS/P), 5.4; post-stimulation IPS/P, 3.42; stimulation corrected (ACTHPRL) IPS/P, 2.8; right baseline IPS/P, 1.64; post-stimulation IPS/P, 9.34; and stimulation corrected IPS/P, 6.92. The left inferior petrosal sinus was the dominant side (Table 1).

Table 1 Bilateral Inferior Petrosal Sinus Sampling Combined with Desmopressin Stimulation Test

The patient underwent endoscopic transsphenoidal clival lesion resection surgery, and the postoperative pathology test results showed EPA (Figure 2). The immunohistochemistry staining results were as follows: CK (+), SYN (+), CgA (+), ACTH (+), growth hormone (GH) (−), LH (−), TSH (−), PRL (−), FSH (−), and Ki-67 (<1% +). The COR level at 10 days after surgery was 15.87 µg/dL, and the ACTH level was 31.37 pg/mL (Table 2).

Table 2 Changes in COR and ACTH Levels During Course of Treatment
Figure 2 Pathological diagnosis of (clivus) ectopic pituitary adenoma. (A) Pituitary adenoma revealing a trabecular and nested structure revealing vascular invasion (hematoxylin and eosin (HE) stain, 200x) composed of two distinct types of cells. (B) ACTH expression in the EPA (200x, ACTH-antibody, Dako).

After admission, her blood and urine COR levels were significantly elevated, and a qualitative diagnosis of CS was obtained. Etiological examination found that ACTH was also significantly elevated, suggesting that the CS was ACTH dependent. The HDDST results showed that the serum COR level was not suppressed by more than 50% and was accompanied by hypokalemia, suggesting that the ACTH-dependent CS may be ectopic ACTH syndrome. Ectopic ACTH syndrome is relatively rare, and the lesions are caused by non-pituitary tumors. No lesions were identified in the lung, thymus, pancreas, and thyroid of our patient. Regarding the IPSS examination, the IPS/P ratio was greater than 2, which suggested that the ectopic ACTH was located intracranially and not at the periphery. Radiologic testing suggested that the pituitary structure was normal and that a space-occupying lesion in the clivus region was present. Therefore, ectopic ACTH-secreting adenoma in the clivus region was considered, and postoperative pathological biopsy was used to confirm the diagnosis.

Discussion

EPA is an extremely rare disease that occurs outside of the sella turcica, and it is not linked to the intrasellar pituitary. The morphology, immunohistochemistry, and hormone activity of EPAs are similar to typical pituitary adenomas. EPAs can manifest as specific or non-specific endocrine disorders, and they account for 0.48% of all pituitary adenomas.9 The pathogenesis of EPA is still currently unknown. It is generally considered that during the development of the anterior pituitary lobe, the incompletely degraded Rathke cleft cyst remnants of the Rathke pouch lead to the formation of EPAs in the nasopharynx, sphenoid, and clivus.10,11 EPA is rare in China. Zhu et al5 recorded 14,357 pituitary gland patients in the last 20 years; of these patients, only 14 were diagnosed with EPA (0.098% of all cases), but none of the lesions originated from the clivus region. Previous literature reviews4,5 revealed that non-functioning EPAs in the clivus region are the most common (50%); the most common hormone-secreting functional adenomas are PRL adenomas and GH adenomas, which account for 25.0% and 21.4% of EPAs, respectively, whereas ACTH-secreting EPAs are extremely rare and only account for 3.6% of cases.

The postoperative pathological and immunohistochemical results of the tumor tissue in the patient demonstrated that it was an ectopic ACTH-secreting pituitary macroadenoma in the clivus region. Most EPAs are microadenomas (diameter <1 cm), except those in the clivus region, which are macroadenomas.5 Adenoma size generally does not affect the patient’s clinical and biochemical characteristics, and it may be related to tumor location or extension.12 Encasement of the internal carotid artery is a characteristic feature of EPA invasion into surrounding tissues.5 Encasement of the right internal carotid artery by the tumor was also observed in our patient. Therefore, surgery cannot completely remove the tumor and may ultimately affect surgical outcomes, and radiotherapy may even be required in the future. The serum COR and ACTH levels of our patient were evaluated 10 days after surgery. Although the levels were significantly lower than those before the surgery, the COR level was still significantly higher than the cutoff value of 1 µg/dL,13,14 suggesting that the patient may not have complete remission due to the incomplete tumor resection in the area adjacent to the carotid artery during surgery. Another feature that was observed in our patient was bone invasion. Because the clivus is composed of abundant cancellous bone that is connected to surrounding bone structures, EPAs or other tumors may cause bone destruction and affect the sphenoidal sinus and cavernous sinus, which is also consistent with literature reports.15,16

Due to the low incidence of EPAs, most EPA cases are reported as case reports in the literature. We performed an English literature search using the PubMed and Web of Science Core Collection databases with the following predetermined terms: “Cushing’s syndrome”, “pituitary adenomas”, “clivus”, “ectopic pituitary adenoma”, and “adrenocorticotropic”. The literature was included if it met the following criteria: (i) the confirmed diagnosis of CS or ectopic ACTH syndrome was described in the literature; (ii) the diagnosis of EPA was confirmed by postoperative inspection; and (iii) EPA occurred in the clivus. After excluding cases of clival invasion from other sites, we found only three reports of ectopic ACTH-secreting adenoma in the clivus region,6–8 and they were all female patients. Ortiz-Suarez and Erickson6 employed transfrontal craniotomy to demonstrate that the ectopic ACTH-secreting adenoma was an extension of extrasellar lesion to the clivus. In a case report by Pluta et al,7 the patient was found to have cavernous sinus and clival ACTH-positive tumors through transphenoidal surgery. In a case report by Aftab et al,8 the patient only presented a space-occupying lesion with unilateral vision loss; the patient was initially diagnosed with clival chordoma, but the postoperative results supported the diagnosis of EPA. Based on preoperative imaging, the possibility of chordoma was also considered to be high in our patient. We combined the clinical manifestation and laboratory test results of the patient and considered the etiology of CS to conclude that the patient had clival ectopic ACTH-secreting adenoma instead of chordoma.

Hormone tests in our patient suggested secondary pituitary-gonadal axis and decreased pituitary-thyroid axis function. These changes in endocrine function may be due to pituitary suppression by hypercortisolism. After surgery, the corresponding markers recovered, indicating that the suppression was transient. The patient has a history of fracture and a bone mineral density suggestive of osteoporosis, which may also be associated with CS hypercortisolemia.

Treatment modalities for EPA include adenoma resection surgery, radiotherapy, and drugs. The first-line recommended treatment is surgical resection. Craniotomy is considered the surgical procedure of choice for EPA, and endoscopic transsphenoidal surgery (TSS) is considered a feasible method for preserving pituitary function while simultaneously treating EPA. However, due to limitations with the surgical operation space, there are still concerns whether sufficient exploration and effective tumor resection can be achieved.17 Because there are few case reports of such patients, the long-term outcomes of these two surgical procedures require further validation. Due to differences in EPA sites and functions, the efficacy of surgery also differs. Zhu et al5 reported that compared to the radical resection rate of sphenoidal sinus and cavernous sinus EPA (72.3% and 73.3%, respectively), the radical resection rate of clival EPA is only 45.0%, and this difference is statistically significant.

The three clival EPA patients described in the three relevant publications6–8 all showed significant improvements in postoperative signs, symptoms, and hormone levels after complete surgical removal of the lesions or combined with radiation therapy. In our patient, however, radical resection of the tumor could not be achieved due to the close proximity of the tumor mass to the right internal carotid artery, and surgery could not be used to achieve complete remission, which is similar to the case reported by Zhu et al.5 For such patients, radiotherapy can be considered as a second-line treatment for EPA. To control hormone levels, drugs and bilateral adrenalectomy are also treatment options.5,18,19

Conclusion

EPA is a rare disease, and clival EPA is even rarer. From the entire diagnosis and treatment course, this unique and rare EPA case was preliminarily diagnosed through a comprehensive hormone panel and IPSS, and it was confirmed by pathology and immunohistochemistry after surgery. In the diagnosis of ectopic ACTH syndrome, attention should also be paid to extremely rare pituitary ectopic sites, such as the sphenoid sinuses, parasellar region, and the clivus, in addition to common sites, such as the lungs, thymus, pancreas, and thyroid.

Data Sharing Statement

The raw data supporting the conclusions of this article will be made available by the authors without undue reservation.

Informed Consent Statement

Prior written permission was obtained from the patient for treatment as well as for the preparation of this manuscript and for publication. Our institution approved the publication of the case details.

Acknowledgments

We would like to thank the patient and her family.

Author Contributions

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

Funding

There is no funding to report.

Disclosure

The authors report no conflicts of interest in this work.

References

1. Senanayake R, Gillett D, MacFarlane J, et al. New types of localization methods for adrenocorticotropic hormone-dependent Cushing’s syndrome. Best Pract Res Clin Endocrinol Metab. 2021;35:101513. doi:10.1016/j.beem.2021.101513

2. Young J, Haissaguerre M, Viera-Pinto O, et al. Management of Endocrine Disease: cushing’s syndrome due to ectopic ACTH secretion: an expert operational opinion. Eur J Endocrinol. 2020;182:R29–r58. doi:10.1530/EJE-19-0877

3. Hayes AR, Grossman AB. The ectopic adrenocorticotropic hormone syndrome: rarely easy, always challenging. Endocrinol Metab Clin North Am. 2018;47:409–425. doi:10.1016/j.ecl.2018.01.005

4. Zhu J, Lu L, Yao Y, et al. Long-term follow-up for ectopic ACTH-secreting pituitary adenoma in a single tertiary medical center and a literature review. Pituitary. 2020;23:149–159. doi:10.1007/s11102-019-01017-y

5. Zhu J, Wang Z, Zhang Y, et al. Ectopic pituitary adenomas: clinical features, diagnostic challenges and management. Pituitary. 2020;23:648–664. doi:10.1007/s11102-020-01071-x

6. Ortiz-Suarez H, Erickson DL. Pituitary adenomas of adolescents. J Neurosurg. 1975;43:437–439. doi:10.3171/jns.1975.43.4.0437

7. Pluta RM, Nieman L, Doppman JL, et al. Extrapituitary parasellar microadenoma in Cushing’s disease. J Clin Endocrinol Metab. 1999;84:2912–2923. doi:10.1210/jcem.84.8.5890

8. Aftab HB, Gunay C, Dermesropian R, et al. “An Unexpected Pit” – ectopic pituitary adenoma. J Endocr Soc. 2021;5:A557–A558. doi:10.1210/jendso/bvab048.1137

9. Li X, Zhao B, Hou B, et al. Case report and literature review: ectopic thyrotropin-secreting pituitary adenoma in the suprasellar region. Front Endocrinol. 2021;12:619161. doi:10.3389/fendo.2021.619161

10. Agely A, Okromelidze L, Vilanilam GK, et al. Ectopic pituitary adenomas: common presentations of a rare entity. Pituitary. 2019;22:339–343. doi:10.1007/s11102-019-00954-y

11. Tajudeen BA, Kuan EC, Adappa ND, et al. Ectopic pituitary adenomas presenting as sphenoid or clival lesions: case series and management recommendations. J Neurol Surg B Skull Base. 2017;78:120–124. doi:10.1055/s-0036-1592081

12. Akirov A, Shimon I, Fleseriu M, et al. Clinical study and systematic review of pituitary microadenomas vs. macroadenomas in cushing’s disease: does size matter? J Clin Med. 2022;11:1558. doi:10.3390/jcm11061558

13. Badiu C. Williams textbook of endocrinology. Acta Endocrinologica. 2019;15:416. doi:10.4183/aeb.2019.416

14. Rollin GA, Ferreira NP, Junges M, et al. Dynamics of serum cortisol levels after transsphenoidal surgery in a cohort of patients with Cushing’s disease. J Clin Endocrinol Metab. 2004;89:1131–1139. doi:10.1210/jc.2003-031170

15. Hu S, Cheng S, Wu Y, et al. A large cavernous sinus giant cell tumor invading clivus and sphenoid sinus masquerading as meningioma: a case report and literature review. Front Surg. 2022;9:861739. doi:10.3389/fsurg.2022.861739

16. Wu X, Ding H, Yang L, et al. Invasive corridor of clivus extension in pituitary adenoma: bony anatomic consideration, surgical outcome and technical nuances. Front Oncol. 2021;11:689943. doi:10.3389/fonc.2021.689943

17. Sun X, Lu L, Feng M, et al. Cushing syndrome caused by ectopic adrenocorticotropic hormone-secreting pituitary adenomas: case report and literature review. World Neurosurg. 2020;142:75–86. doi:10.1016/j.wneu.2020.06.138

18. Szabo Yamashita T, Sada A, Bancos I, et al. Differences in outcomes of bilateral adrenalectomy in patients with ectopic ACTH producing tumor of known and unknown origin. Am J Surg. 2021;221:460–464. doi:10.1016/j.amjsurg.2020.08.047

19. Szabo Yamashita T, Sada A, Bancos I, et al. Bilateral adrenalectomy: differences between cushing disease and Ectopic ACTH-producing tumors. Ann Surg Oncol. 2020;27:3851–3857. doi:10.1245/s10434-020-08451-4

Creative Commons License This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License. By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.

 

Characterization of Adrenal miRNA-Based Dysregulations in Cushing’s Syndrome

Abstract

MiRNAs are important epigenetic players with tissue- and disease-specific effects. In this study, our aim was to investigate the putative differential expression of miRNAs in adrenal tissues from different forms of Cushing’s syndrome (CS). For this, miRNA-based next-generation sequencing was performed in adrenal tissues taken from patients with ACTH-independent cortisol-producing adrenocortical adenomas (CPA), from patients with ACTH-dependent pituitary Cushing’s disease (CD) after bilateral adrenalectomy, and from control subjects. A confirmatory QPCR was also performed in adrenals from patients with other CS subtypes, such as primary bilateral macronodular hyperplasia and ectopic CS. Sequencing revealed significant differences in the miRNA profiles of CD and CPA. QPCR revealed the upregulated expression of miR-1247-5p in CPA and PBMAH (log2 fold change > 2.5, p < 0.05). MiR-379-5p was found to be upregulated in PBMAH and CD (log2 fold change > 1.8, p < 0.05). Analyses of miR-1247-5p and miR-379-5p expression in the adrenals of mice which had been exposed to short-term ACTH stimulation showed no influence on the adrenal miRNA expression profiles. For miRNA-specific target prediction, RNA-seq data from the adrenals of CPA, PBMAH, and control samples were analyzed with different bioinformatic platforms. The analyses revealed that both miR-1247-5p and miR-379-5p target specific genes in the WNT signaling pathway. In conclusion, this study identified distinct adrenal miRNAs as being associated with CS subtypes.

1. Introduction

Cushing’s syndrome (CS) results from the excessive secretion of cortisol, leading to visceral obesity, resistance to insulin, osteoporosis, and altered lipid and glucose metabolism [1,2]. Excessive production of cortisol by the adrenal glands can be either ACTH-dependent or -independent. In the majority of patients, hypercortisolism is due to ACTH secretion by corticotroph adenomas of the pituitary gland (Cushing’s disease, CD) or by ectopic tumors [3]. Approximately 20% of cases are ACTH-independent, where cortisol is secreted autonomously by the adrenal cortex. The pathology of ACTH-independent cases is diverse; they are most often caused by unilateral cortisol-producing adrenocortical adenomas (CPA). Rare causes are cortisol-secreting adrenocortical carcinomas (ACC), primary bilateral macronodular adrenocortical hyperplasia (PBMAH), bilateral CPAs, and primary pigmented nodular adrenal disease (PPNAD) [4,5]. Irrespective of the subtype, prolonged exposure to cortisol in CS is associated with increased mortality and cardiovascular morbidity in its patients [6]. Treatment is based on the underlying cause of hypercortisolism, with pituitary surgery or adrenalectomy being the preferred choice. Medical therapy options in CS are few and consist of pituitary-directed drugs, steroid synthesis inhibitors, and glucocorticoid receptor antagonists [7]. For the timely diagnosis and targeted management of CS and its subtypes, a comprehensive understanding of cortisol secretion, in terms of canonical signaling pathways as well as upstream epigenetic factors, is needed.
MiRNA molecules have emerged as key epigenetic players in the transcriptional regulation of cortisol production. Briefly, the deletion of Dicer in adrenals, a key miRNA processing enzyme, revealed diverse expression changes in miRNAs along with related changes in steroidogenic enzymes such as Cyp11b1 [8]. Furthermore, key enzymes in the cortisol biosynthesis pathway, namely Cyp11a1, Cyp21a1, Cyp17a1, Cyp11b1, and Cyp11b2, were also found to be regulated by various miRNAs (miRNA-24, miRNA-125a-5p, miRNA-125b-5p, and miRNA-320a-3p) in in vitro studies [9]. Consequently, various studies have also characterized miRNA expression profiles in CS subtypes. Importantly, miRNA expression in the corticotropinomas of CD patients was found to vary according to USP8 mutation status [10]. Other studies have also identified specific miRNA candidates and associated target genes in the adrenals of patients with PPNAD [11], PBMAH [12,13], and massive macronodular adrenocortical disease [14]. Interestingly, no common miRNA candidates were found among these studies, indicating the specificity of miRNAs to the different underlying pathologies in CS.
There are limited studies directly comparing miRNA expression profiles of ACTH-dependent and ACTH-independent CS patients. Consequently, in our previous study, we found differences in expression profiles when comparing circulating miRNAs in CD and CPA patients [15]. We hypothesized that the presence of ACTH possibly influences the miRNA profile in serum due to the upstream differential expression in the origin tissues. In this study, we aim to further explore this hypothesis by comparing the miRNA expression profile of adrenal tissues in ACTH-dependent and ACTH-independent CS. In brief, miRNA specific sequencing was performed in two prevalent subtypes of CS: in CD, the most prevalent ACTH-dependent form; and in CPA, the most prevalent ACTH-independent form. Specific miRNA candidates related to each subtype were further validated in other forms of CS. To further investigate our hypothesis, the response of miRNA candidates following ACTH stimulation was assessed in mice, and the expression of miRNAs in murine adrenals was subsequently investigated. Finally, an extensive targeted gene analysis was performed based on in silico predictions, RNA-seq data, and luciferase assays.

2. Results

2.1. Differentially Expressed miRNAs

NGS revealed differentially expressed miRNAs between the different groups analyzed (Figure 1). CD and CPA taken together as CS showed a differentially expressed profile (42 significant miRNAs) in comparison to controls. Moreover, individually, CPA and CD were found to show a significantly different expression profile in comparison to controls (n = 38 and n = 17 miRNAs, respectively). Interestingly, there were no significantly upregulated genes in the adrenals of patients with CD in comparison to the control adrenals. A comparative analysis of the top significant miRNAs (log2 fold change (log2 FC) > 1.25 & p < 0.005) between the two groups was performed and the representative Venn diagrams are given in Figure 2. Briefly, miR-1247-5p, miR-139-3p, and miR-503-5p were significantly upregulated in CPA, in comparison to both CD and controls. Furthermore, miR-150-5p was specifically upregulated in CPA as compared to CD. Several miRNAs (miR-486-5p, miR-551b-3p, miR-144-5p, miR-144-3p, and miR-363-3p) were found to be significantly downregulated in the groups of CPA and CD in comparison to controls. MiR-19a-3p and miR-873-5p were found to be commonly downregulated in CPA in comparison to both CD and controls. Principal component analyses based on miRNA sequencing did not identify any major clusters among the samples. Furthermore, the miRNA profile was not different among the CPA samples based on the mutation status of PRKACA (Supplementary Materials Figure S1).
Ijms 23 07676 g001 550
Figure 1. Differentially expressed miRNAs from sequencing. Volcano plot showing the relationship between fold change (log2 fold change) and statistical significance (−log10 p value). The red points in the plot represent significantly upregulated miRNAs, while blue points represent significantly downregulated miRNAs. CPA, cortisol producing adenoma; CD, Cushing’s disease; Cushing’s syndrome represents CPA and CD, taken together.
Ijms 23 07676 g002 550
Figure 2. Venn analyses of the common significant miRNAs from each group. The significantly expressed miRNAs from each sequencing analysis were shortlisted and compared between the groups. CPA, cortisol producing adenoma; CD, Cushing’s disease.

2.2. Validation and Selection of Candidate miRNAs

For validation by QPCR, the most significant differentially expressed miRNAs (log2 FC > 1.25 & p < 0.005) among the groups were chosen (Table S1). According to the current knowledge, upregulated miRNAs are known to contribute more to pathology than downregulated miRNAs [16]. Since the total number of significantly upregulated miRNAs was six, all these miRNAs were chosen for validation. Contrarily, 25 miRNAs were significantly downregulated among the groups. In particular, miR-486-5p, miR-551b-3p, miR-144-5p, miR-144-3p, and miR-363-3p were found to be commonly downregulated in the CS group in comparison to controls; therefore, these miRNAs were chosen for validation.
Among the upregulated miRNA candidates, miR-1247-5p QPCR expression confirmed the NGS data (Figure 3A, Table S1). Moreover, miR-150-5p and miR-139-3p were upregulated in CPA specifically in comparison to CD, and miR-379-5p was upregulated in CD in comparison to controls by QPCR. In the case of downregulated genes, none of the selected miRNAs could be confirmed by QPCR (Figure 3B). Thus, analysis of the six upregulated and five downregulated miRNAs from NGS yielded two significantly upregulated miRNA candidates, miR-1247-5p in CPA and miR-379-5p in CD, when compared to controls. These miRNA candidates were taken up for further QPCR validation in an independent cohort of other subtypes of CS (Figure 4), namely ACTH-dependent ectopic CS (n = 3) and ACTH-independent PBMAH (n = 10). The QPCR analysis in the other subtypes revealed miR-1247-5p to be consistently upregulated in ACTH-independent CS (PBMAH and CPA) in comparison to ACTH-dependent CS (CD and ectopic CS) and controls. On the other hand, miR-379-5p was upregulated in CD and PBMAH in comparison to controls.
Ijms 23 07676 g003 550
Figure 3. QPCR analyses of significant miRNAs from sequencing analyses. Data are represented as mean ± standard deviation (SD) of −dCT values: (A) Expression analysis of significantly upregulated miRNAs; (B) Expression analysis of common significantly downregulated miRNAs. Housekeeping gene: miR-16-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*).
Ijms 23 07676 g004 550
Figure 4. QPCR analyses of significantly upregulated miRNAs from validation QPCR. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: miR-16-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*).

2.3. In Vivo Assessment of ACTH-Independent miR-1247-5p

To analyze the influence of ACTH on miRNA expression, the expression of miR-1247-5p and miR-379-5p were assessed in the adrenal tissues of ACTH stimulated mice at different time points. For this analysis, miR-96-5p was taken as a positive control, as it has previously been reported to be differentially expressed in ACTH stimulated mice [17]. The analyses revealed that the expression of miR-1247-5p and miR-379-5p did not change at different timepoints of the ACTH stimulation (Figure 5). Meanwhile, the positive control of mir-96-5p showed a dynamic expression pattern with upregulation after 10 min, followed by downregulation at the subsequent 30 and 60 min time points, in concordance with previously reported findings [18].
Ijms 23 07676 g005 550
Figure 5. Analysis of miRNA expression in ACTH stimulated mice tissue. QPCR analyses of positive controls, miR-96-5p, and candidates miR-379-5p and miR-1247-5p. Mice were injected with ACTH, and adrenals were collected at different timepoints to assess the impact of ACTH on miRNA expression. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: miR-26a-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*).

2.4. In Silico Analyses of miRNA Targets

Two diverse approaches were employed for a comprehensive in silico analysis of the miRNA targets. First, the predicted targets of miR-1247-5p and miR-379-5p were taken from the TargetScan database, which identified miRNA–mRNA target pairs based on sequence analyses [19]. The expression status of these targets was then checked in the RNA sequencing data from CPA vs. controls (miR-1247-5p) and PBMAH vs. controls (miR-379-5p). Targets that showed significant expression changes in the sequencing data were shortlisted (Figure 6A). Among the 1061 predicted miR-1247-5p targets, 28 genes were found to show significant expression changes in CPA (20 upregulated, 8 downregulated). On the other hand, for 124 predicted miR-379-5p targets, 23 genes were found to show significant expression changes in PBMAH (20 upregulated, 3 downregulated). Interestingly, the selected targets were found to be unique for each miRNA, except for FICD (FIC domain protein adenylyltransferase) (Figure 6B).
Ijms 23 07676 g006 550
Figure 6. (A) Differentially expressed target genes of miRNAs from sequencing. Data are represented as log2 fold change in comparison to the controls. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05. (B) Venn analyses of common significant miRNA target genes and related pathways. The significantly expressed targets from each sequencing analysis were shortlisted and compared between the groups. Predicted pathways of the targets from the Panther database were shortlisted and compared between the groups.

2.5. In Vitro Analyses of miR-1247-5p Targets

For in vitro analyses, we focused on downregulated targets, as we expect our upregulated miRNA candidates to cause a downregulation of the target mRNAs. For our downregulated mRNAs, only targets of miR-1247-5p were found to have published links to CS, namely Cyb5a, Gabbr2, and Gnaq (Table 1). Therefore, these three targets were then verified by QPCR in the groups of CPA, CD, PBMAH, ectopic CS, and controls (Figure 6). Only Cyb5A was found to be significantly downregulated in ACTH-dependent forms (ectopic CS and CD) as well as in ACTH-independent CS (PBMAH and CPA) in comparison to controls. Consequently, to assess whether Cyb5a is indeed regulated by miR-1247-5p, a dual luciferase assay was performed. To prove our hypothesis, treatment of Cyb5a-WT cells with miR-1247-5p mimic was expected to lead to a reduced luminescence, whereas no effects were expected in cells treated with the miR-1247-5p inhibitor or the Cyb5a-mutant (with a mutation in the miR-1247-5p binding site). As shown in Figure 7, transfection of miR-1247-5p significantly reduced luminescence from Cyb5a-WT in comparison to cells transfected with Cyb5a-WT and miR-1247-5p inhibitors. However, these predicted binding results were not found to be specific, as there were no significant differences when compared to wells transfected with Cyb5a-WT alone (Figure 8). Consecutively, when the mutated Cyb5a-Mut were transfected along with the mimics and inhibitors, no significant differences in luminescence were observed in the transfected population. Thus, direct interaction between miR-1247-5p and its predicted target gene Cyb5A could not be conclusively proven using this luciferase assay.
Ijms 23 07676 g007 550
Figure 7. QPCR analyses of the top predicted targets of miR-1247-5p. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: PPIA. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*).
Ijms 23 07676 g008 550
Figure 8. Results of dual luminescence assay on cells transfected with miR-1247-5p mimics and related controls. Cells were transfected with plasmids containing either the WT or Mut miRNA binding sequence in Cyb5a. Either miR-1247-5p mimics or miR-1247-5p inhibitors were transfected together with the respective plasmids. Data are represented as mean ± standard error of mean (SEM) of relative luminescence unit values. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p value < 0.05 (*).
Table 1. Analysis of the predicted targets of miR-1247-5p and their expression levels in comparison to controls (log2 fold change). Published literature on target genes in reference to CS is highlighted in bold.
Table

2.6. Pathway Analyses of miRNA Targets

For the pathway analysis (Reactome) we used the 28 predicted miRNA-1247-5p targets and the 23 predicted miRNA-379-5p targets from TargetScan, which were significantly differently expressed in the RNA-seq (Figure 6). Concurrently, the pathways commonly enriched by both miRNAs included the WNT signaling pathway and N-acetyl-glucosamine synthesis (Figure 9A). As a complementary approach, in silico analyses were also performed based on the targets from miRTarBase. In this database, targets are shortlisted based on published experimental results. In this analysis, miR-1247-5p (n = 21) and miR-379-5p targets (n = 85) were unique. While the validated targets of miR-379-5p were found to show significant changes in expression in the RNA-seq data from PBMAH (n = 12), none of the validated miR-1247-5p targets were found to show significant expression changes in the RNA-seq data from CPA. Therefore, all the validated targets of the miRNAs were subjected to pathway analyses (Panther). Interestingly, the WNT signaling pathway was also found to be commonly regulated by both miRNAs using this approach (Figure 9B). Finally, the expression status of target genes related to WNT signaling pathways were checked in our RNA-seq data (Figure S2). Given the upregulated status of the miRNAs, a downregulated expression of its target genes was expected. However, a significantly upregulated expression was observed for DVL1 in CPA in comparison to controls and for ROR1 in PBMAH in comparison to controls.
Ijms 23 07676 g009 550
Figure 9. Pathway analyses of miRNA target genes. (A) The predicted targets were matched with the RNA-seq expression data. For miR-1247-5p, CPA vs. controls expression data; and for miR-379-5p, PBMAH vs. controls expression data. The significantly expressed target genes were then subjected to pathway analyses by Reactome. The significantly enriched pathway networks (p < 0.05) and their related genes are given. (B) The experimentally validated target genes from miRTarBase were analyzed for their role in pathways by the Panther database. The target genes and their related pathways are given. The commonly represented pathways are marked in bold.

3. Discussion

MiRNAs are fine regulators of both physiology and pathology and have diverse roles as diagnostic biomarkers as well as therapeutic targets. While circulating miRNAs have been investigated as potential biomarkers for hypercortisolism in CS subtypes (36), comprehensive analyses of their pathological role in CS subtypes have not yet been performed. This study hoped to uncover the pathological role of miRNAs in different CS subtypes as well as identify unique epigenetic targets contributing to hypercortisolism in these subtypes. As such, miRNA sequencing was performed in the ACTH-independent CPA and ACTH-dependent CD, with additional QPCR validation in PBMAH and ectopic CS. As expected, miRNA expression profiles in CD and CPA were very different.

3.1. ACTH-Independent Upregulated miRNAs in CS

Among the analyzed miRNAs, only miR-1247-5p and miR-379-5p showed the most prominent changes in expression levels. Briefly, miR-1247-5p was significantly upregulated in ACTH-independent forms of CS, CPA, and PBMAH (Figure 1 and Figure 3) while miR-379-5p was found to be upregulated in CD and PBMAH, in comparison to controls. Even though CD and PBMAH represent CS subtypes with different ACTH dependence, albeit both with hyperplastic tissue, it is interesting to find a shared miRNA expression status. Concurrently, miRNAs have been identified as dynamic players in regulating the acute effect of ACTH on adrenal steroidogenesis in in vivo murine studies [20,21]. Further diverse miRNAs have been characterized to regulate steroidogenesis in ACTH and dexamethasone treated rats [22] (suppressed ACTH) as well as in in vitro studies [20]. It is possible that miR-379-5p contributes to the adrenal hyperplasia present in both PBMAH and CD by targeting specific genes related to hyperplasia, and miR-1247-5p by contributing to cortisol production independent of ACTH regulation in CPA and PBMAH.
Interestingly, the miRNA candidates (mir-1247-5p and miR-379-5p) in our study have not been previously characterized in any of these studies. Furthermore, the expression of mir-1247-5p and miR-379-5p were found to be independent of ACTH stimulation, underlying their role in CS independently of the HPA axis control and postulating specific regulatory processes.

3.2. Target Genes of miRNAs in CS

Initially, we focused on the selection of known CS specific target genes that could be directly repressed by miRNAs, thereby contributing to pathology. The predicted target genes of miR-1247-5p and miR-379-5p were assessed for their downregulated expression status in the RNA-seq data. Among the selected target genes, only Cyb5a was found to be significantly downregulated in all forms of CS (Figure 6). Cytochrome b5 (CYB5A) is a marker of the zona reticularis and is an important regulator of androstenedione production [23,24]. Based on its role in adrenal steroidogenesis, it is possible that Cyb5a is downregulated by miR1247-5p. To prove our hypothesis, a dual luciferase assay was performed in HELA cell line to identify a direct interaction between Cyb5a and miR-1247-5p (Figure 7). Unfortunately, a direct interaction could not be proven, indicating that miR-1247-5p perhaps regulates its target genes in different ways.

3.3. Pathway Analyses of miRNA Targets

To identify miRNA specific regulatory processes, comprehensive target and pathway analyses were performed. Independent pathway analyses of the respective targets with two different databases of Reactome and Panther showed the WNT signaling pathway as a common targeted pathway of both mir-1247-5p and miR-379-5p (Figure 8). The WNT signaling pathway represents a crucial regulator in diverse developmental as well as pathological processes with tissue-specific effects [25,26]. Consequently, the WNT pathway has been largely characterized as one of the dysregulated pathophysiological mechanisms in CPA. Mutations in PRKACA, one of the WNT signaling proteins, are present in approximately 40% of CPA [27]. In the case of CD, dysregulated WNT signaling has been characterized as promoting proliferation in ACTH-secreting pituitary adenomas [28]. Moreover, activating mutations in beta catenin, one of the WNT signaling pathways, has been characterized as driving adrenal hyperplasia through both proliferation-dependent and -independent mechanisms [29]. Thus, it could be hypothesized that by targeting specific genes in the pathway, miRNAs drive specific pathophysiological processes in diverse CS subtypes.

3.4. MiRNA Target Genes in WNT Signaling

DVL1 (TargetScan) and DVL3 (miRTar) are the shortlisted target genes of miR-1247-5p in the WNT signaling pathway. These genes are members of canonical WNT pathways and, importantly, activation of the cytoplasmic effector Dishevelled (Dvl) is a critical step in WNT/β-catenin signaling initiation [30,31]. Interestingly, no difference in DVL1 and DVL3 gene expression was found in the analyses of ACTH-secreting pituitary adenomas [32]. Therefore, it could be possible that DVL1 and DVL3 are only targeted by miR-1247-5p specifically in the adrenal of CPA and PBMAH patients, leading to its characterized tumor progression. EDN1, TGFBR1 (TargetScan), and ROR1 (miRTar) were the target genes of miR-379-5p related to the WNT pathway. In epithelial ovarian cancer, Endothelin-1 (EDN-1) was found to regulate the epithelial–mesenchymal transition (EMT) and a chemoresistant phenotype [33]. In the case of receptor tyrosine kinase-like orphan receptor 1 (ROR1), higher expression of the gene was associated with a poor prognosis in ovarian cancer [34]. Concurrently, suppression of TGFBR1-mediated signaling by conditional knockout in mice was found to drive the pathogenesis of endometrial hyperplasia, independent of the influence of ovarian hormones [35]. Therefore, it could be hypothesized that the dysregulated expression of these factors in adrenals could trigger similar hyperplastic effects mediated by these factors, as in ovarian tissues.

3.5. Bottlenecks and Future Outlook

Interestingly, among these genes, only DVL1 and ROR1 were found to be significantly upregulated in the RNA-seq data (Figure S2). The major regulatory role of miRNAs in gene expression come from their ability to repress gene expression at the level of transcription and translation. There are also reports of miRNA-mediated gene upregulation; however, the physiological evidence of the role is still unresolved [36]. Therefore, it is interesting to see the selected targets of miR-1247-5p and miR-379-5p upregulated. Moreover, it should be noted that most of the experimentally validated miRNA targets were identified by CLIP methods [37]. Crosslinking immunoprecipitation (CLIP) are binding assays that provide genome-wide maps of potential miRNA-target gene interactions based on sequencing. Moreover, these assays do not make functional predictions on the outcome of miRNA binding, and neither do upregulation or downregulation [38,39]. Therefore, in our current experimental setting, we could only identify potential miRNA target genes and speculate on their pathological role based on the published literature and in silico analyses. Furthermore, extensive mechanistic analyses based on these potential targets could help in elaborating the specific epigenetic pathways that fine-tune CS pathology in different subtypes.

4. Materials and Methods

4.1. Sample Collection and Ethics Approval

All patients were registered in the German Cushing’s Registry, the ENS@T or/and NeoExNET databases (project number protocol code 379-10 and 152-10). The study was approved by the Ethics Committee of the University of Munich. All experiments were performed according to relevant guidelines and protocols, and written informed consent was obtained from all patients involved. The adrenal samples used in the sequencing (miRNA and RNA) belong to the same patient.
For miRNA-specific next-generation sequencing (NGS), a total of 19 adrenocortical tissue samples were used. The cohort consisted of the following patient groups: ACTH-independent CPA, n = 7; ACTH-dependent hypertrophic adrenals of CD patients after bilateral adrenalectomy, n = 8; normal adjacent adrenal tissue from patients with pheochromocytoma as controls, n = 8. For QPCR validation, the patient groups included adrenal tissue from ACTH-independent PBMAH, n = 10, and ACTH-dependent ectopic CS, n = 3.
In the case of mRNA sequencing, a total of 23 adrenocortical tissue samples were used. This includes the following patient groups: CPA, n = 7; PBMAH, n = 8; normal adjacent adrenal tissue from patients with pheochromocytoma as controls, n = 8.
The clinical characteristics of the patients are given in Table 2. Furthermore, of the eight CPA samples in the study, three of them carried known somatic driver mutations in the PRKACA gene and in the ten PBMAH samples, two carried germline mutations in the ARMC5 gene.
Table 2. Clinical characteristics of the patient groups. Data are given as median with 25th and 75th percentiles in brackets. CPA, cortisol producing adenoma; CD, Cushing’s disease.
Table
The adrenal tissues were stored at −80 °C. Total RNA isolation was carried out from all adrenal cortex samples by an RNeasy Tissue Kit (Qiagen, Hilden, Germany). The isolated RNA was kept frozen at −80 °C until further use.

4.2. MiRNA and RNA Sequencing

RNA integrity and the absence of contaminating DNA were confirmed by Bioanalyzer RNA Nano (Agilent Technologies, Santa Clara, CA, USA) and by Qubit DNA High sensitivity kits, respectively. Sequencing libraries were prepared using the Illumina TruSeq Small RNA Library Preparation Kit. NGS was performed on 2 lanes of an Illumina HiSeq2500 (Illumina, CA, USA) multiplexing all samples (paired end read, 50 bp). The quality of sequencing reads was verified using FastQC0.11.5 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc, date last accessed: 13 March 2020) before and after trimming. Adapters were trimmed using cutadapt [40]. Reads with <15 bp and >40 bp insert sequences were discarded. An alignment of reads was performed using miRBase V21 [41,42] with sRNAbench [43]. EdgeR and DeSeq in R were used for further analyses [44,45]. MiRNAs with at least 5 raw counts per library were included. RNA-seq was performed by Qiagen, Hilden, Germany. For mRNA, sequencing was performed on Illumina NextSeq (single end read, 75 bp). Adapter and quality trimming were performed by the “Trim Reads” tool from CLC Genomics Workbench. Furthermore, reads were trimmed based on quality scores. The QC reports were generated by the “QC for Sequencing Reads” tool from CLC Genomics Workbench. Read mapping and gene quantification were performed by the “RNA-seq Analysis” tool from CLC Genomics Workbench [46]. The miRNA-seq data generated in this study have been submitted to the NCBI (PRJNA847385).

4.3. Validation of Individual miRNAs

MiRNAs and genes significantly differentially expressed by NGS were validated by QPCR. Reverse transcription of miRNA-specific cDNA was performed by using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Munich, Germany), and the reverse transcription of RNA genes was done by using the Superscript VILO cDNA synthesis Kit (Thermo Fisher Scientific, Munich, Germany). 50 ng of RNA was used for each of the reverse transcription reactions. Quantitative real-time PCR was performed using the TaqMan Fast Universal PCR Master Mix (2×) (Thermo Fisher Scientific, Munich, Germany) on a Quantstudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Munich, Germany) in accordance with the manufacturer’s protocol. All QPCR reactions were performed in a final reaction volume of 20 μL and with 1 μL of 1:5 diluted cDNA. Negative control reactions contained no cDNA templates. Gene expression was quantified using the relative quantification method by normalization with reference gene [47]. Statistical analysis using the bestkeeper tool was used to compare and select the best reference gene with stable expression across the human adrenal samples [48]. Reference genes with significantly different Ct values (p-value < 0.01) between the samples were excluded. Furthermore, primer efficiency and the associated correlation coefficient R2 of the selected reference gene were determined by the standard curve method in serially diluted cDNA samples [49]. In the case of miRNA reference genes, miR-16-5p [48,50,51] and RNU6B [52] previously used in similar studies were compared. MiR-16-5p was found to show the most stable expression levels across the samples with a p-value of 0.452 in comparison to RNU6B which had a p-value of 0.001. In the case of RNA reference genes, PPIA [53] and GAPDH [54] were compared. Here, PPIA was found to show the most stable expression levels across the samples with a p-value of 0.019 in comparison to GAPDH which had a p-value of 0.003. Therefore, these genes were used for the normalization of miRNA and RNA expression in human adrenal samples.

4.4. Target Screening

In silico prediction of the possible miRNA targets was performed using the miRNA target database, TargetScan, and miRTarBase [19,37]. The top predicted targets were further screened based on their expression status in the RNA-seq data from the adrenocortical tissues of CPA, PBMAH, and controls (unpublished data). Pathway analyses of the targets were performed using Reactome [55] and Panther [56] online platforms. The selected downregulated targets were analyzed by QPCR in the adrenocortical samples to confirm their expression status. The successfully validated candidates were then analyzed for regulation by the miRNA using a dual luciferase assay [57].

4.5. Dual Luciferase Assay

The interaction between the predicted 3′-UTR region of Cyb5a and miR-1247-5p was detected using a luciferase activity assay. The 3′UTR sequences of Cyb5a (129 bp) containing the predicted miR-1247-5p binding sites (psiCHECK-2 Cyb5a 3′UTR WT) were cloned into the psiCHECK-2 vector (Promega, Fitchburg, WI, USA). A QuikChange Site-Directed Mutagenesis kit (Agilent Technologies, CA, USA) was used to mutate the miR-1247-5p binding site (psiCHECK-2 Cyb5a 3′UTR mutant) according to the manufacturer’s protocol. All the sequences were verified by Sanger sequencing. Then, 200 ng of the plasmid was used for each transfection. Synthetic miR-1247-5p mimics and specific oligonucleotides that inhibit endogenous miR-1247-5p (miR-1247-5p inhibitors) were purchased from Promega and 100 nmol of the molecules were used for each transfection according to the manufacturer’s protocol. For the assay, HeLa cells were seeded in 96-well plates and incubated for 24 h. The following day, cells were transfected using the following different conditions: (1) psiCHECK-2 Cyb5a 3′UTR WT + miR-1247-5p mimic; (2) psiCHECK-2 Cyb5a 3′UTR WT + miR-1247-5p inhibitor; (3) psiCHECK-2 Cyb5a 3′UTR WT + water; (4) psiCHECK-2 Cyb5a 3′UTR mutant + miR-1247-5p mimic; (5) psiCHECK-2 Cyb5a 3′UTR mutant + miR-1247-5p inhibitor; (6) psiCHECK-2 Cyb5a 3′UTR mutant + water. Forty-eight hours later, luciferase activity in the cells was measured using the dual luciferase assay system (Promega, Fitchburg, WI, USA) in accordance with the manufacturer’s instructions. Renilla luciferase activity was normalized to firefly luciferase activity. Each treatment was performed in triplicate. Any interaction between the cloned gene, Cyb5a (WT and mutant), and miR-1247-5p mimic is accompanied by a decrease in luminescence. This decrease in luminescence would not be observed when the plasmids are transfected with the miR-1247-5p inhibitor, indicating that observed luminescence differences are caused by specific interactions between the plasmid and the miR-1247-5p mimic. Transfection of the plasmid with water corrects any background interactions between the cloned gene and endogenous miRNAs in the culture.

4.6. In Vivo ACTH Stimulation

Experiments were performed on 13-week-old C57BL/6 J female mice (Janvier, Le Genest-Saint-Isle, France). Mice were intraperitoneally injected with 1 mg/kg of ACTH (Sigma Aldrich, Munich, Germany) and adrenals were collected after 10, 30, and 60 min of injections. In addition, control adrenals were collected from mice at baseline conditions (0 min). Mice were killed by cervical dislocation and adrenals were isolated, snap-frozen in liquid nitrogen, and stored at −80 °C for later RNA extraction. MiR-26a was taken as a housekeeping gene in the QPCR [58]. All mice were maintained in accordance with facility guidelines on animal welfare and approved by Landesdirektion Sachsen, Chemnitz, Germany.

4.7. Statistical Analysis and Software

R version 3.6.1 was used for the statistical analyses. To identify RNAs differentially expressed, a generalized linear model (GLM, a flexible generalization of ordinary linear regression that allows for variables that have distribution patterns other than a normal distribution) in the software package edgeR (Empirical Analysis of DGE in R) was employed to calculate p-values [45,59]. p-values were adjusted using the Benjamin–Hochberg false discovery rate (FDR) procedure [60]. Disease groups were compared using the unpaired Mann–Whitney test, and to decrease the false discovery rate a corrected p-value was calculated using the Benjamin–Hochberg method. p adjusted < 0.05 and log2 fold change >1.25 was applied as the cut-off for significance for NGS data. GraphPad Prism Version 8 was used for the statistical analysis of QPCR. To calculate differential gene expression, the dCt method (delta Ct (cycle threshold) value equals target miRNA’s Ct minus housekeeping miRNA’s Ct) was used (Microsoft Excel 2016, Microsoft, Redmond, WA, USA). For QPCR, an ANOVA test with Bonferroni correction was used [61] to assess significance; p-values < 0.05 were considered significant.

5. Conclusions

In conclusion, while comprehensive information regarding the role of miRNAs in acute and chronic phases of steroidogenesis is available, there is little known about the pathological independent role of miRNAs in the pathology of CS. In our study, we have described ACTH-independent miR-1247-5p and miR-379-5p expression in CS for the first time. Thus, by regulating different genes in the WNT signaling pathway, the miRNAs may individually contribute to the Cushing’s pathology in specific subtypes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23147676/s1.

Author Contributions

Conceptualization, S.V., A.C. and A.R.; methodology, S.V., R.Z. and M.E.; software, S.V. and M.E.; validation, R.Z., A.O., D.W. and B.W.; formal analysis, S.V.; investigation, S.V., R.Z., M.E., A.O. and D.W.; resources, A.C., B.W., M.R. and A.R.; data curation, S.V. and R.Z.; writing—original draft preparation, S.V., R.Z. and A.R.; writing—review and editing, S.S., M.R. and A.R.; visualization, S.V.; supervision, A.R.; project administration, A.R.; funding acquisition, A.C., S.S., M.R. and A.R. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG) (within the CRC/Transregio 205/1 “The Adrenal: Central Relay in Health and Disease”) to A.C., B.W., S.S., M.R. and A.R., and individual grant SB 52/1-1 to S.S. This work is part of the German Cushing’s Registry CUSTODES and has been supported by a grant from the Else Kröner-Fresenius Stiftung to MR (2012_A103 and 2015_A228). A.R. was supported by the FöFoLe Program of the Ludwig Maximilian University, Munich. We thank I. Shapiro, A. Parl, C. Kühne, and S. Zopp for their technical support.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the Ludwig Maximilian University, Munich (protocol code 379-10, 152-10 and 20 July2021).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The miRNA-seq data generated in this study have been submitted to the NCBI (PRJNA847385).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kotłowska, A.; Puzyn, T.; Sworczak, K.; Stepnowski, P.; Szefer, P. Metabolomic biomarkers in urine of cushing’s syndrome pa-tients. Int. J. Mol. Sci. 2017, 18, 294. [Google Scholar] [CrossRef] [PubMed][Green Version]
  2. Valassi, E.; Tabarin, A.; Brue, T.; Feelders, R.A.; Reincke, M.; Netea-Maier, R.; Toth, M.; Zacharieva, S.; Webb, S.M.; Tsagarakis, S.; et al. High mortality within 90 days of diagnosis in patients with Cushing’s syndrome: Results from the ERCUSYN registry. Eur. J. Endocrinol. 2019, 181, 461–472. [Google Scholar] [CrossRef]
  3. Stratakis, C. Cushing syndrome caused by adrenocortical tumors and hyperplasias (corticotropin-independent Cushing syn-drome). Endocr. Dev. 2008, 13, 117–132. [Google Scholar]
  4. Jarial, K.D.S.; Walia, R.; Nahar, U.; Bhansali, A. Primary bilateral adrenal nodular disease with Cushing’s syndrome: Varying aeti-ology. BMJ. Case. Rep. 2017, 2017, bcr2017220154. [Google Scholar] [CrossRef] [PubMed]
  5. Kamilaris, C.D.C.; Stratakis, C.A.; Hannah-Shmouni, F. Molecular Genetic and Genomic Alterations in Cushing’s Syndrome and Primary Aldosteronism. Front. Endocrinol. 2021, 12, 142. [Google Scholar] [CrossRef] [PubMed]
  6. Feelders, R.A.; Pulgar, S.J.; Kempel, A.; Pereira, A.M. The burden of Cushing’s disease: Clinical and health-related quality of life aspects. Eur. J. Endocrinol. 2012, 167, 311–326. [Google Scholar] [CrossRef] [PubMed][Green Version]
  7. Feelders, R.A.; Newell-Price, J.; Pivonello, R.; Nieman, L.K.; Hofland, L.J.; Lacroix, A. Advances in the medical treatment of Cush-ing’s syndrome. Lancet Diabetes Endocrinol. 2019, 7, 300–312. [Google Scholar] [CrossRef]
  8. Krill, K.T.; Gurdziel, K.; Heaton, J.H.; Simon, D.P.; Hammer, G.D. Dicer Deficiency Reveals MicroRNAs Predicted to Control Gene Expression in the Developing Adrenal Cortex. Mol. Endocrinol. 2013, 27, 754–768. [Google Scholar] [CrossRef]
  9. Robertson, S.; Diver, L.A.; Alvarez-Madrazo, S.; Livie, C.; Ejaz, A.; Fraser, R.; Connell, J.M.; MacKenzie, S.M.; Davies, E. Regulation of Corticosteroidogenic Genes by MicroRNAs. Int. J. Endocrinol. 2017, 2017, 2021903. [Google Scholar] [CrossRef][Green Version]
  10. Bujko, M.; Kober, P.; Boresowicz, J.; Rusetska, N.; Zeber-Lubecka, N.; Paziewska, A.; Pekul, M.; Zielinski, G.; Styk, A.; Kunicki, J.; et al. Differential microRNA Expression in USP8-Mutated and Wild-Type Corticotroph Pituitary Tumors Reflect the Difference in Protein Ubiquitination Processes. J. Clin. Med. 2021, 10, 375. [Google Scholar] [CrossRef]
  11. Iliopoulos, D.; Bimpaki, E.I.; Nesterova, M.; Stratakis, C.A. MicroRNA Signature of Primary Pigmented Nodular Adrenocortical Disease: Clinical Correlations and Regulation of Wnt Signaling. Cancer Res. 2009, 69, 3278–3282. [Google Scholar] [CrossRef] [PubMed][Green Version]
  12. Tan, X.-G.; Zhu, J.; Cui, L. MicroRNA expression signature and target prediction in familial and sporadic primary macronodular adrenal hyperplasia (PMAH). BMC Endocr. Disord. 2022, 22, 11. [Google Scholar] [CrossRef]
  13. Vaczlavik, A.; Bouys, L.; Violon, F.; Giannone, G.; Jouinot, A.; Armignacco, R.; Cavalcante, I.P.; Berthon, A.; Letouzé, E.; Vaduva, P.; et al. KDM1A inactivation causes hereditary food-dependent Cushing syndrome. Genet. Med. 2021, 24, 374–383. [Google Scholar] [CrossRef]
  14. Bimpaki, E.I.; Iliopoulos, D.; Moraitis, A.; Stratakis, C.A. MicroRNA signature in massive macronodular adrenocortical disease and implications for adrenocortical tumorigenesis. Clin. Endocrinol. 2010, 72, 744–751. [Google Scholar] [CrossRef]
  15. Vetrivel, S.; Zhang, R.; Engel, M.; Altieri, B.; Braun, L.; Osswald, A.; Bidlingmaier, M.; Fassnacht, M.; Beuschlein, F.; Reincke, M.; et al. Circulating microRNA Expression in Cushing’s Syndrome. Front. Endocrinol. 2021, 12, 10. [Google Scholar] [CrossRef] [PubMed]
  16. O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of microRNA biogenesis, mechanisms of actions, and circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef][Green Version]
  17. Butz, H.; Patócs, A. MicroRNAs in endocrine tumors. Electron. J. Int. Fed. Clin. Chem. Lab. Med. 2019, 30, 146–164. [Google Scholar]
  18. Riester, A.; Issler, O.; Spyroglou, A.; Rodrig, S.H.; Chen, A.; Beuschlein, F. ACTH-Dependent Regulation of MicroRNA As Endogenous Modulators of Glucocorticoid Receptor Expression in the Adrenal Gland. Endocrinology 2012, 153, 212–222. [Google Scholar] [CrossRef][Green Version]
  19. Huang, X.; Zhong, R.; He, X.; Deng, Q.; Peng, X.; Li, J.; Luo, X. Investigations on the mechanism of progesterone in inhibiting endo-metrial cancer cell cycle and viability via regulation of long noncoding RNA NEAT1/microRNA-146b-5p mediated Wnt/β-catenin signaling. IUBMB Life 2019, 71, 223–234. [Google Scholar] [CrossRef][Green Version]
  20. Azhar, S.; Dong, D.; Shen, W.-J.; Hu, Z.; Kraemer, F.B. The role of miRNAs in regulating adrenal and gonadal steroidogenesis. J. Mol. Endocrinol. 2020, 64, R21–R43. [Google Scholar] [CrossRef]
  21. Allen, M.J.; Sharma, S. Physiology, Adrenocorticotropic Hormone (ACTH). StatPearls 2021. Available online: https://www.ncbi.nlm.nih.gov/books/NBK500031/ (accessed on 8 December 2021).
  22. Hu, Z.; Shen, W.-J.; Cortez, Y.; Tang, X.; Liu, L.-F.; Kraemer, F.B.; Azhar, S. Hormonal Regulation of MicroRNA Expression in Steroid Producing Cells of the Ovary, Testis and Adrenal Gland. PLoS ONE 2013, 8, e78040. [Google Scholar] [CrossRef][Green Version]
  23. Ghayee, H.K.; Rege, J.; Watumull, L.M.; Nwariaku, F.E.; Carrick, K.S.; Rainey, W.E.; Miller, W.L.; Auchus, R.J. Clinical, biochemical, and molecular characterization of macronodular adrenocortical hyperplasia of the zona reticularis: A new syndrome. J. Clin. Endocrinol. Metab. 2011, 96, E243–E250. [Google Scholar] [CrossRef] [PubMed][Green Version]
  24. Nakamura, Y.; Fujishima, F.; Hui, X.-G.; Felizola, S.J.A.; Shibahara, Y.; Akahira, J.-I.; McNamara, K.M.; Rainey, W.E.; Sasano, H. 3βHSD and CYB5A double positive adrenocortical cells during adrenal development/aging. Endocr. Res. 2015, 40, 8–13. [Google Scholar] [CrossRef] [PubMed][Green Version]
  25. Ng, L.F.; Kaur, P.; Bunnag, N.; Suresh, J.; Sung, I.C.H.; Tan, Q.H.; Gruber, J.; Tolwinski, N.S. WNT Signaling in Disease. Cells 2019, 8, 826. [Google Scholar] [CrossRef][Green Version]
  26. Song, J.L.; Nigam, P.; Tektas, S.S.; Selva, E. microRNA regulation of Wnt signaling pathways in development and disease. Cell. Signal. 2015, 27, 1380–1391. [Google Scholar] [CrossRef][Green Version]
  27. Beuschlein, F.; Fassnacht, M.; Assié, G.; Calebiro, D.; Stratakis, C.A.; Osswald, A.; Ronchi, C.L.; Wieland, T.; Sbiera, S.; Faucz, F.R.; et al. Constitutive Activation of PKA Catalytic Subunit in Adrenal Cushing’s Syndrome. N. Engl. J. Med. 2014, 370, 1019–1028. [Google Scholar] [CrossRef][Green Version]
  28. Ren, J.; Jian, F.; Jiang, H.; Sun, Y.; Pan, S.; Gu, C.; Chen, X.; Wang, W.; Ning, G.; Bian, L.; et al. Decreased expression of SFRP2 promotes development of the pituitary corticotroph adenoma by upregulating Wnt signaling. Int. J. Oncol. 2018, 52, 1934–1946. [Google Scholar] [CrossRef][Green Version]
  29. Pignatti, E.; Leng, S.; Yuchi, Y.; Borges, K.S.; Guagliardo, N.A.; Shah, M.S.; Ruiz-Babot, G.; Kariyawasam, D.; Taketo, M.M.; Miao, J.; et al. Beta-Catenin Causes Adrenal Hyperplasia by Blocking Zonal Transdifferentiation. Cell Rep. 2020, 31, 107524. [Google Scholar] [CrossRef]
  30. Grumolato, L.; Liu, G.; Mong, P.; Mudbhary, R.; Biswas, R.; Arroyave, R.; Vijayakumar, S.; Economides, A.N.; Aaronson, S.A. Canonical and noncanonical Wnts use a common mechanism to activate completely unrelated coreceptors. Genes Dev. 2010, 24, 2517–2530. [Google Scholar] [CrossRef][Green Version]
  31. Tauriello, D.V.F.; Jordens, I.; Kirchner, K.; Slootstra, J.W.; Kruitwagen, T.; Bouwman, B.A.M.; Noutsou, M.; Rüdiger, S.G.D.; Schwamborn, K.; Schambony, A.; et al. Wnt/β-catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc. Natl. Acad. Sci. USA 2012, 109, E812–E820. [Google Scholar] [CrossRef][Green Version]
  32. Colli, L.M.; Saggioro, F.; Neder Serafini, L.; Camargo, R.C.; Machado, H.; Moreira, A.C.; Antonini, S.R.; De Castro, M. Components of the Canonical and Non-Canonical Wnt Pathways Are Not Mis-Expressed in Pituitary Tumors. PLoS ONE 2013, 8, e62424. [Google Scholar] [CrossRef] [PubMed][Green Version]
  33. Rosanò, L.; Cianfrocca, R.; Tocci, P.; Spinella, F.; Di Castro, V.; Caprara, V.; Semprucci, E.; Ferrandina, G.; Natali, P.G.; Bagnato, A. En-dothelin A receptor/β-arrestin signaling to the Wnt pathway renders ovarian cancer cells resistant to chemotherapy. Cancer Res. 2014, 74, 7453–7464. [Google Scholar] [CrossRef] [PubMed][Green Version]
  34. Zhang, H.; Qiu, J.; Ye, C.; Yang, D.; Gao, L.; Su, Y.; Tang, X.; Xu, N.; Zhang, D.; Xiong, L.; et al. ROR1 expression correlated with poor clinical outcome in human ovarian cancer. Sci. Rep. 2014, 4, 5811. [Google Scholar] [CrossRef] [PubMed][Green Version]
  35. Gao, Y.; Li, S.; Li, Q. Uterine epithelial cell proliferation and endometrial hyperplasia: Evidence from a mouse model. Mol. Hum. Reprod. 2014, 20, 776–786. [Google Scholar] [CrossRef]
  36. Orang, A.V.; Safaralizadeh, R.; Kazemzadeh-Bavili, M. Mechanisms of miRNA-Mediated Gene Regulation from Common Downregulation to mRNA-Specific Upregulation. Int. J. Genom. 2014, 2014, 970607. [Google Scholar]
  37. Huang, H.Y.; Lin, Y.C.D.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. miRTarBase 2020: Up-dates to the experimentally validated microRNA–target interaction database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [PubMed][Green Version]
  38. Liu, W.; Wang, X. Prediction of functional microRNA targets by integrative modeling of microRNA binding and target expres-sion data. Genome Biol. 2019, 20, 18. [Google Scholar] [CrossRef] [PubMed]
  39. Wang, X. Improving microRNA target prediction by modeling with unambiguously identified microRNA-target pairs from CLIP-ligation studies. Bioinformatics 2016, 32, 1316–1322. [Google Scholar] [CrossRef]
  40. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  41. Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, D68–D73. [Google Scholar] [CrossRef][Green Version]
  42. Griffiths-Jones, S. miRBase: The MicroRNA Sequence Database. Methods Mol. Biol. 2006, 342, 129–138. [Google Scholar] [PubMed]
  43. Aparicio-Puerta, E.; Lebrón, R.; Rueda, A.; Gómez-Martín, C.; Giannoukakos, S.; Jáspez, D.; Medina, J.M.; Zubković, A.; Jurak, I.; Fromm, B.; et al. sRNAbench and sRNAtoolbox 2019: Intuitive fast small RNA profiling and differential expression. Nucleic Acids Res. 2019, 47, W530–W535. [Google Scholar] [CrossRef] [PubMed][Green Version]
  44. Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [PubMed][Green Version]
  45. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef][Green Version]
  46. Liu, C.-H.; Di, Y.P. Analysis of RNA Sequencing Data Using CLC Genomics Workbench. Methods Mol. Biol. 2020, 2102, 61–113. [Google Scholar] [CrossRef]
  47. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper–Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  48. Wang, X.; Zhang, X.; Yuan, J.; Wu, J.; Deng, X.; Peng, J.; Wang, S.; Yang, C.; Ge, J.; Zou, Y. Evaluation of the performance of serum miRNAs as normalizers in microRNA studies focused on cardiovascular disease. J. Thorac. Dis. 2018, 10, 2599–2607. [Google Scholar] [CrossRef]
  49. Geigges, M.; Gubser, P.M.; Unterstab, G.; Lecoultre, Y.; Paro, R.; Hess, C. Reference Genes for Expression Studies in Human CD8 + Naïve and Effector Memory T Cells under Resting and Activating Conditions. Sci. Rep. 2021, 10, 9411. [Google Scholar] [CrossRef]
  50. Song, J.; Bai, Z.; Han, W.; Zhang, J.; Meng, H.; Bi, J.; Ma, X.; Han, S.; Zhang, Z. Identification of Suitable Reference Genes for qPCR Analysis of Serum microRNA in Gastric Cancer Patients. Dig. Dis. Sci. 2011, 57, 897–904. [Google Scholar] [CrossRef]
  51. Szabó, D.R.; Luconi, M.; Szabó, P.M.; Tóth, M.; Szücs, N.; Horányi, J.; Nagy, Z.; Mannelli, M.; Patócs, A.; Rácz, K.; et al. Analysis of cir-culating microRNAs in adrenocortical tumors. Lab. Investig. 2014, 94, 331–339. [Google Scholar] [CrossRef][Green Version]
  52. Butz, H.; Mészáros, K.; Likó, I.; Patocs, A. Wnt-Signaling Regulated by Glucocorticoid-Induced miRNAs. Int. J. Mol. Sci. 2021, 22, 11778. [Google Scholar] [CrossRef] [PubMed]
  53. Muñoz, J.J.; Anauate, A.C.; Amaral, A.G.; Ferreira, F.M.; Watanabe, E.H.; Meca, R.; Ormanji, M.S.; Boim, M.A.; Onuchic, L.F.; Heilberg, I.P. Ppia is the most stable housekeeping gene for qRT-PCR normalization in kidneys of three Pkd1-deficient mouse models. Sci. Rep. 2021, 11, 19798. [Google Scholar] [CrossRef] [PubMed]
  54. Xia, X.; Liu, Y.; Liu, L.; Chen, Y.; Wang, H. Selection and verification of the combination of reference genes for RT-qPCR analysis in rat adrenal gland development. J. Steroid. Biochem. Mol. Biol. 2021, 208, 105821. [Google Scholar] [CrossRef] [PubMed]
  55. Gillespie, M.; Jassal, B.; Stephan, R.; Milacic, M.; Rothfels, K.; Senff-Ribeiro, A.; Griss, J.; Sevilla, C.; Matthews, L.; Gong, C.; et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022, 50, D687–D692. [Google Scholar] [CrossRef]
  56. Mi, H.; Ebert, D.; Muruganujan, A.; Mills, C.; Albou, L.-P.; Mushayamaha, T.; Thomas, P.D. PANTHER version 16: A revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic Acids Res. 2021, 49, D394–D403. [Google Scholar] [CrossRef]
  57. Wu, T.; Lin, Y.; Xie, Z. MicroRNA-1247 inhibits cell proliferation by directly targeting ZNF346 in childhood neuroblastoma. Biol. Res. 2018, 51, 13. [Google Scholar] [CrossRef][Green Version]
  58. Muñoz, J.J.; Anauate, A.; Amaral, A.G.; Ferreira, F.M.; Meca, R.; Ormanji, M.S.; Boim, M.A.; Onuchic, L.F.; Heilberg, I.P. Identification of housekeeping genes for microRNA expression analysis in kidney tissues of Pkd1 deficient mouse models. Sci. Rep. 2020, 10, 231. [Google Scholar] [CrossRef][Green Version]
  59. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef][Green Version]
  60. Hu, Z.; Gao, S.; Lindberg, D.; Panja, D.; Wakabayashi, Y.; Li, K.; Kleinman, J.E.; Zhu, J.; Li, Z. Temporal dynamics of miRNAs in human DLPFC and its association with miRNA dysregulation in schizophrenia. Transl. Psychiatry 2019, 9, 196. [Google Scholar] [CrossRef]
  61. Esteva-Socias, M.; Gómez-Romano, F.; Carrillo-Ávila, J.A.; Sánchez-Navarro, A.L.; Villena, C. Impact of different stabilization methods on RT-qPCR results using human lung tissue samples. Sci. Rep. 2020, 10, 3579. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
%d bloggers like this: