Catastrophic ACTH-secreting Pheochromocytoma

Posted on June 6, 2023 by MaryO

Abstract

Summary

Cushing’s syndrome due to ectopic adrenocorticotropic hormone (ACTH) secretion (EAS) by a pheochromocytoma is a challenging condition. A woman with hypertension and an anamnestic report of a ‘non-secreting’ left adrenal mass developed uncontrolled blood pressure (BP), hyperglycaemia and severe hypokalaemia. ACTH-dependent severe hypercortisolism was ascertained in the absence of Cushingoid features, and a psycho-organic syndrome developed. Brain imaging revealed a splenial lesion of the corpus callosum and a pituitary microadenoma. The adrenal mass displayed high uptake on both 18F-FDG PET/CT and 68Ga-DOTATOC PET/CT; urinary metanephrine levels were greatly increased. The combination of antihypertensive drugs, high-dose potassium infusion, insulin and steroidogenesis inhibitor normalized BP, metabolic parameters and cortisol levels; laparoscopic left adrenalectomy under intravenous hydrocortisone infusion was performed. On combined histology and immunohistochemistry, an ACTH-secreting pheochromocytoma was diagnosed. The patient’s clinical condition improved and remission of both hypercortisolism and catecholamine hypersecretion ensued. Brain magnetic resonance imaging showed a reduction of the splenial lesion. Off-therapy BP and metabolic parameters remained normal. The patient was discharged on cortisone replacement therapy for post-surgical hypocortisolism. EAS due to pheochromocytoma displays multifaceted clinical features and requires prompt diagnosis and multidisciplinary management in order to overcome the related severe clinical derangements.

Learning points

  • A small but significant number of cases of adrenocorticotropic hormone (ACTH)-dependent Cushing’s syndrome are caused by ectopic ACTH secretion by neuroendocrine tumours, which is usually associated with severe hypercortisolism causing severe clinical and metabolic derangements.
  • Ectopic ACTH secretion by a pheochromocytoma is exceedingly rare but can be life-threatening, owing to the simultaneous excess of both cortisol and catecholamines.
  • The combination of biochemical and hormonal testing and imaging procedures is mandatory for the diagnosis of ectopic ACTH secretion, and in the presence of an adrenal mass, the possibility of an ACTH-secreting pheochromocytoma should be taken into account.
  • Immediate-acting steroidogenesis inhibitors are required for the treatment of hypercortisolism, and catecholamine excess should also be appropriately managed before surgical removal of the tumour.
  • A multidisciplinary approach is required for the treatment of this challenging entity.
Keywords: Adult; Female; White; Italy; Adrenal; Pituitary; Unique/unexpected symptoms or presentations of a disease; May; 2023

Background

Cushing’s syndrome (CS) is a rare endocrine disease characterized by high levels of glucocorticoids; it increases morbidity and mortality due to cardiovascular and infectious diseases (1, 2, 3).

To diagnose CS, adrenocorticotropic hormone (ACTH)-dependent disease must be distinguished from ACTH-independent disease, and pituitary ACTH production from ectopic production. About 20% of ACTH-dependent cases arise from ectopic ACTH secretion (EAS) (2, 3, 4). EAS is most often due to aberrant ACTH production by small-cell lung carcinoma or neuroendocrine tumours originating in the lungs or gastrointestinal tract; this, in turn, strongly increases cortisol production by the adrenal glands (3, 4, 5).

Since the first-line treatment of EAS is the surgical removal of the ectopic ACTH-secreting tumour, its prompt and accurate localization is crucial.

Rapid cortisol reduction by means of immediate-acting steroidogenesis inhibitors (4) is mandatory in order to treat the related endocrine, metabolic and electrolytic derangements. EAS by a pheochromocytoma is exceedingly rare and can be life-threatening.

We describe the case of a woman with hypertension and a known ‘non-secreting’ left adrenal mass, who manifested uncontrolled blood pressure (BP), hyperglycaemia, hypokalaemia and psycho-organic syndrome associated with damage of the splenium of the corpus callosum. These findings were eventually seen to be related to an ACTH-secreting left pheochromocytoma, which was ascertained by hormonal evaluation and morphological and functional imaging assessment and confirmed by histopathology/immunostaining. Hormonal hypersecretion resolved after adrenalectomy and metabolic derangements normalized.

Case presentation

A 72-year-old woman with hypertension was taken to the emergency department because of increased BP (200/100 mm Hg). High BP (190/100 mmHg) was confirmed, whereas oxygen saturation (98%), heart rate (84 bpm) and lung and abdomen examination were normal. Electrocardiogram and chest x-ray were unremarkable. Captopril 50 mg orally, followed by intramuscular clonidine, normalized BP.

The patient looked thin and reported significant weight loss (10 kg) over the previous 6 months; she was on antihypertensive therapy with bisoprolol 5 mg/day and irbesartan 150 mg/day, and ezetimibe 10 mg/day for dyslipidaemia. The patient’s records included a previous diagnosis in another hospital of normofunctioning multinodular goitre and a 2.5 cm-left solid inhomogeneous adrenal mass with well-defined margins, which was found on CT performed 6 years earlier during the work-up for hypertension. On the basis of hormonal data and absent uptake on 123I metaiodobenzylguanidine scintigraphy, the adrenal lesion had been deemed to be non-functioning and follow-up had been advised. Unfortunately, only initial cortisol (15.7 μg/dL) and 24-h urine-free cortisol (UFC) levels (32.5 μg/24 h) were retrievable; both proved normal.

Investigations

Blood chemistry showed neutrophilic leucocytosis, hyperglycaemia with increased glycated haemoglobin, severe hypokalaemia and metabolic alkalosis (Table 1). Potassium infusion (50 mEq in 500 mL saline/24 h) was rapidly started, together with a subcutaneous rapid-acting insulin analogue and prophylactic enoxaparin. The patient experienced mental confusion, hallucinations and restlessness; non-enhanced computed tomography (CT) of the brain revealed a hypodense area of the splenium of the corpus callosum, possibly due to metabolic damage (Fig. 1A).

Figure 1View Full Size
Figure 1

Non-enhanced CT showing a hypodense area of the splenium of the corpus callosum (arrows), without mass effect (A, axial view). Contrast-enhanced MR image showing a hypointense pituitary lesion (arrow) which enhances more slowly than normal pituitary parenchyma, deemed suspicious for microadenoma (B, coronal view). FLAIR MR image showing hyperintense signal of the splenium of the corpus callosum (asterisk), which partially extended to the crux of the left fornix (arrow) (C, axial view). As the lesion showed no restricted diffusion on DWI (D, axial view), an ischaemic lesion was excluded. A progressive reduction in the extension of the hyperintense signal in the splenium of the corpus callosum (arrowheads) and in the crux of the left fornix (arrows) was observed on FLAIR MR images (2 months (E); 3 months (F); axial view). CT, computed tomography; DWI, diffusion-weighted imaging; FLAIR, fluid-attenuated inversion recovery; MR, magnetic resonance.

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2023, 2; 10.1530/EDM-22-0308

Table 1Hormonal and biochemical evaluation of patient throughout hospitalization and follow-up.

Normal range On hospital admission After surgery
10 days 2 months 3 months 6 months 9 months 12 months 16 months
ACTH (pg/mL) 9–52 551 7 37 50 29.5 26 40.9 52
Morning cortisol† (µg/dL) 7–19.2 63.4 14 5.1 3.5 3.8 4.2 7.2 12.8
After 1 mg overnight dexamethasone
 ACTH 583
 Cortisol 60
DHEAS (µg/dL) 9.4–246 201
24-h urinalysis (µg/24 h)
 Adrenaline 0–14.9 95.5
 Noradrenaline 0–66 1133
 Metanephrine 74–297 1927
 Normetanephrine 105–354 1133
Chromogranin A 0–108 290
Renin (supine) (µU/mL) 2.4–29 3.9 14.6
Aldosterone (supine) (ng/dL) 3–15 3.4 12.5
LH (mIU/mL)* > 10 0.3 65.8
FSH (mIU/mL)* > 25 1.9 116
PRL (ng/mL) 3–24 13.7
FT4 (ng/dL) 0.9–1.7 1.1 1.2
FT3 (pg/mL) 1.8–4.6 1.1 2.7
TSH (µU/mL) 0.27–4.2 0.23 1.3
PTH (pg/mL) 15–65 166
Calcium (mg/dL) 8.2–10.2 8.2
Calcitonin (pg/mL) 0–10 1
Glycaemia (mg/dL) 60–110 212 69 73 83
Potassium (mEq/L) 3.5–5 2.4 3.3 3.9 4.2 3.7 5 4.4 3.9
Leucocytes (K/µL) 4.0–9.3 15.13
HbA1c (mmol/mol) 20–42 55 30
HCO3− (mEq/L) 22–26 41.8

*For menopausal age; †07:00–10:00 h.

 

The patient was transferred to the internal medicine ward. Although potassium infusion was increased to 120 mEq/day, serum levels did not normalize; a mineralocorticoid receptor antagonist (potassium canreonate) was therefore introduced, but the effect was partial. In order to control BP, the irbersartan dose was increased (300 mg/day) and amlodipine (10 mg/day) was added.

The combination of severe hypertension, newly occurring diabetes and resistant hypokalaemia prompted us to hypothesize a common endocrine aetiology.

A thorough hormonal array showed very high ACTH and cortisol levels, whereas supine renin and aldosterone levels were in the low-normal range (Table 1). Since our patient proved repeatedly non-compliant with 24-h urine collection, UFC could not be measured.

After an overnight 1 mg dexamethasone suppression test, cortisol levels remained unchanged, whereas ACTH levels slightly increased (Table 1). Notably, the patient showed no Cushingoid features. Gonadotropin levels were inappropriately low for the patient’s age; FT4 levels were normal, whereas FT3 and thyroid-stimulating hormone (TSH) levels were reduced and calcitonin levels were normal (Table 1). HbA1c levels were increased (Table 1).

Finally, secondary hyperparathyroidism, associated with low-normal calcium levels and reduced vitamin D levels, was found (Table 1).

Brain contrast-enhanced magnetic resonance (MR) imaging revealed a 5-mm median posterior pituitary microadenoma (Fig. 1B) and a hyperintense lesion of the splenium of the corpus callosum (Fig. 1C). Diffusion-weighted MR images of the lesion showed no restricted diffusion (Fig. 1D), thus excluding an ischaemic origin. Petrosal venous sampling for ACTH determination at baseline and after CRH stimulation was excluded, as it was deemed a high-risk procedure, given the patient’s poor condition.

Since the ACTH and cortisol levels were greatly increased and were associated with severe hypokalaemia, EAS was hypothesized; total-body contrast-enhanced CT revealed the left adrenal mass (3 cm), which showed regular margins and heterogeneous enhancement (Fig. 2A and B) and measured 25 Hounsfield units. There was no evidence of adrenal hyperplasia in the contralateral adrenal gland. The adrenal mass showed intense tracer uptake on both 18F-FDG PET/CT (Fig. 2C and D), suggestive of adrenal malignancy or functioning tumour, and 68Ga-DOTATOC PET/CT (Fig. 3), which is characteristic of a neuroendocrine lesion. No other sites of suspicious tracer uptake were detected.

Figure 2View Full Size
Figure 2

Contrast-enhanced abdominal computed tomography showing a 3-cm left adrenal mass (arrow) with well-defined margins and inhomogeneus enhancement, deemed compatible with an adenoma (A, coronal view; B, axial view). The adrenal mass showed high uptake (SUV max: 7.3) on 18F-FDG PET/CT (C, coronal view; D, axial view).

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2023, 2; 10.1530/EDM-22-0308

Figure 3View Full Size
Figure 3

The left adrenal mass displaying very high uptake (SUV max: 40) on 68Ga-DOTATOC PET/CT (arrow, axial view).

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2023, 2; 10.1530/EDM-22-0308

 

Bisoprolol was withdrawn, and 24-h urinary catecholamine, metanephrine and normetanephrine levels proved significantly increased, as were chromogranin A levels (Table 1). In sum, an ACTH-secreting pheochromocytoma was suspected and the pituitary microadenoma was deemed a likely incidental finding.

The patient’s mental state worsened, fluctuating from sopor to restlessness, which required parenteral neuroleptics and restraint. An electroencephalogram revealed a specific slowdown of cerebral electrical activity. Following rachicentesis, the cerebrospinal fluid showed pleocytosis (lympho-monocytosis), whereas a culture test and polymerase chain reaction for common neurotropic agents were negative. The neurologist hypothesized a psycho-organic syndrome secondary to severe metabolic derangement. Intravenous ampicillin, acyclovir and B vitamins were empirically started. The patient was transferred to the subintensive unit, where a nasogastric tube and central venous catheter were inserted, and enteral nutrition was started.

Treatment

Ketoconazole was started at a dosage of 200 mg twice daily; both cortisol and ACTH levels significantly decreased over a few days (Fig. 4), with a progressive decrease in glucose levels and normalization of potassium levels and BP on therapy. Subsequently, ketoconazole was titrated to 600 mg/day owing to a new increase in cortisol levels, which eventually normalized (Fig. 4). Of note, ACTH levels partially decreased on ketoconazole treatment (Fig. 4).

Figure 4View Full Size
Figure 4

ACTH and cortisol levels throughout the patient’s hospitalization and follow-up.

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2023, 2; 10.1530/EDM-22-0308

 

Doxazosin 2 mg/day was added and the patient’s systolic BP blood settled at around 100 mm Hg; after a few days, bisoprolol was restarted. Contrast-enhanced MR showed a partial reduction of the hyperintense splenial lesion (Fig. 1E). Despite the severe clinical condition and the high risks of adrenal surgery, the patient’s relatives strongly requested the procedure and laparoscopic left adrenalectomy was planned. Alpha-blocker and fluid infusion were continued, ketoconazole was withdrawn the day before surgery, and a 100 mg IV bolus of hydrocortisone was administered just before the operation, followed by 200 mg/day, at first in continuous infusion, then as a 100 mg bolus every 8 h. After the removal of the left adrenal mass, noradrenaline infusion was required, owing to the occurrence of severe hypotension.

Outcome and follow-up

Pathology revealed a 2.5 cm reddish-brown encapsulated tumour, which was compatible with pheochromocytoma (Fig. 5A and B); ACTH immunostaining was positive in about 30% of tumour cells (Fig. 5C). This confirmed the diagnostic hypothesis of an ACTH-secreting pheochromocytoma. The tumour was stained for Chromogranin A (Fig. 5D). There were no signs of adrenal cortex hyperplasia in the resected gland. Thorough germinal genetic testing, comprising the commonest pheochromocytoma/paraganglioma genes: CDKN1B, KIF1B, MEN1, RET, SDHA, SDHB, SDHC, SDHD, SDHAF2 and TMEM127, was negative.

Figure 5View Full Size
Figure 5

Histological images of adrenal pheochromocytoma: the tumour is composed of well-defined nests of cells (‘zellballen’) (A; haematoxylin-eosin stain (HE), ×20) with pleomorphic nuclei with prominent nucleoli, basophilic or granular amphophilic cytoplasm (B; HE, ×40). The mitotic index was low: 1 mitosis per 30 high-power fields, and Ki-67 was 1%. On immunohistochemistry, cytoplasmatic ACTH staining was found in about 30% of tumour cells (C; ×20), whereas most tumour cells were stained for chromogranin A (D; ×20).

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2023, 2; 10.1530/EDM-22-0308

 

One week after surgery ACTH levels had dropped to a low-normal value: 7 pg/mL, and cortisol levels (before morning hydrocortisone bolus administration) were normal: 14 µg/dL (Fig. 4). The patient’s clinical status slowly improved and the nasogastric tube was removed; intravenous hydrocortisone was carefully tapered until withdrawal and high-dose oral cortisone acetate (62.5 mg/day) was started. This dose was initially required since BP remained low (systolic: 90 mm Hg); thereafter, cortisone was reduced to 37.5 mg/day. Plasma cortisol levels before morning cortisone administration were reduced (Fig. 4). A new MR of the brain showed a further partial reduction of the splenial lesion (Fig. 1F). The patient was discharged with normal off-therapy BP and metabolic parameters.

During follow-up, she fully recovered, and BP and metabolic parameters remained normal. Gonadotropin levels became adequate for the patient’s age, and TSH and renin/aldosterone levels normalized (Table 1). Hypoadrenalism, however, persisted for more than 1 year; as the last hormonal evaluation, 16 months after surgery, showed normal baseline cortisol levels, the cortisone dose was tapered (12.5 mg/day) and further hormonal examination was scheduled (Table 1). ACTH and cortisol levels throughout the patient’s hospitalization and follow-up are shown in Fig. 4.

Discussion

The diagnosis of EAS is challenging and requires two steps: confirmation of increased ACTH and cortisol levels and anatomic distinction from pituitary sources of ACTH overproduction. Besides metabolic derangements (hyperglycaemia, hypertension), EAS-related severe hypercortisolism may cause profound hypokalaemia (3, 4, 5).

In our patient, the combination of worsening hypertension, newly occurring diabetes and resistant hypokalaemia raised the suspicion of a common endocrine cause.

ACTH-dependent severe hypercortisolism was ascertained, and subsequent brain MR revealed a pituitary microadenoma.

The diagnosis of CS requires the combination of two abnormal test results: 24-h UFC, midnight salivary cortisol and/or abnormal 1 mg dexamethasone suppression testing (2, 6). ACTH evaluation (low/normal-high) is fundamental to tailoring the imaging technique.

The very high cortisol levels found in our patient were unchanged after overnight dexamethasone testing, whereas UFC could not be assessed owing to the lack of compliance with urine collection. The accuracy of the UFC assays, however, may be impaired by cortisol precursors and metabolites. Salivary cortisol assessment was not performed since the specific assay is not available in our hospital.

The combination of ACTH-dependent severe hypercortisolism and hypokalaemia prompted us to suspect EAS. The differential diagnosis between pituitary and ectopic ACTH-dependent CS involves high-dose (8 mg) dexamethasone suppression testing, which has relatively low diagnostic accuracy (6). Owing to the patient’s very high cortisol levels and severe hypokalaemia, this testing was not performed, on account of the risks of administering corticosteroids in a patient already exposed to excessive levels (6). Furthermore, owing to the increase in ACTH levels observed after overnight dexamethasone testing, we postulated the possible occurrence of glucocorticoid-driven positive feedback on ACTH secretion, which has been described in EAS, including cases of pheochromocytoma (7).

Finally, in the case of EAS suspected of being caused by pheochromocytoma, we do not recommend performing high-dose dexamethasone suppression testing, owing to the risk of triggering a catecholaminergic crisis (8).

The dynamic tests commonly used to distinguish patients with EAS from those with Cushing’s disease are the CRH stimulation test and the desmopressin stimulation test, either alone or in combination with CRH testing (6). Owing to the rapid worsening of our patient’s condition, dynamic testing was not done; however, the clinical picture and hormonal/biochemical data were suggestive of EAS.

EAS is mainly (45–50%) due to neuroendocrine tumours, mostly of the lung (small-cell lung cancer and bronchial tumours), thymus or gastrointestinal tract; however, up to 20% of ACTH-secreting tumours remain occult (3, 4, 5).

ACTH-secreting pheochromocytomas are responsible for about 5% of cases of EAS (3, 4, 9, 10). Indeed, this rate ranges widely, from 2.5% (11) to 15% (12), according to the different case series. Patients with EAS due to pheochromocytoma present with severe CS, overt diabetes mellitus, hypertension and hypokalaemia (3); symptoms of catecholamine excess may be unapparent (3), making the diagnosis more challenging.

A recent review of 99 patients with ACTH- and/or CRH-secreting pheochromocytomas found that the vast majority displayed a Cushingoid phenotype (10); by contrast, another review of 24 patients reported that typical Cushingoid features were observed in only 30% of patients, whereas weight loss was a prevalent clinical finding (13). We hypothesized that the significant weight loss reported by our patient was largely due to the hypermetabolic state induced by catecholamines, which directly reduce visceral and subcutaneous fat, as recently reported (14).

Our patient showed no classic stigmata of CS, owing to the rapid onset of severe hypercortisolism (10, 13), whereas she had worsening hypertension and newly occurring diabetes mellitus, which were related to both cortisol and catecholamine hypersecretion; hypokalaemia was deemed to be secondary to severe hypercortisolism. Indeed, greatly increased cortisol levels act on the mineralocorticoid receptors of the distal tubule after saturating 11β-hydroxysteroid dehydrogenase type 2, leading to hypokalaemia (4). Consequently, hypokalaemia is much more common (74–95% of patients) in EAS than in classic Cushing’s disease (10%) (3, 4, 10). This apparent mineralocorticoid excess suppresses renin and aldosterone secretion, as was ascertained in our patient.

In this setting, the most effective way to manage hypokalaemia is to treat the hypercortisolism itself by administering immediate-acting steroidogenesis inhibitors, combined with potassium infusion and a mineralocorticoid receptor-antagonist (e.g. spironolactone) at an appropriate dosage (100–300 mg/day) (4).

In ACTH-secreting pheochromocytoma, cortisol hypersecretion potentiates catecholamine-induced hypertension by stimulating the phenol-etholamine-N-methyl–transferase enzyme, which transforms noradrenaline to adrenaline (4). Indeed, in our patient, the significant ketoconazole-induced reduction in cortisol secretion led to satisfactory BP control on antihypertensive drugs. After the biochemical diagnosis of pheochromocytoma, a selective alpha-blocker was added, and after a few days, a beta-blocker was restarted in order to control reflex tachycardia (15).

Our patient had greatly increased ACTH levels (>500 pg/mL) associated with very high cortisol levels (>60 µg/dL), which, together with the finding of hypokalaemia, prompted us to hypothesize EAS. With regard to these findings, ACTH levels are usually higher (>200 pg/mL) in patients with EAS than in those with CS due to a pituitary adenoma; however, considerable overlapping occurs (3, 11, 16). Most patients with ACTH-secreting pheochromocytomas in those series had ACTH levels >300 pg/mL, and a few had normal ACTH levels (9), thus complicating the diagnosis. In addition, patients with EAS usually have higher cortisol levels than those with ACTH-secreting adenomas (3, 11).

In our patient, the left adrenal mass was deemed the culprit of EAS, and owing to very high urinary metanephrine levels, a pheochromocytoma was suspected.

It can be assumed that the adrenal tumour, which was anamnestically reported as ‘non-secreting’, but on which only part of the initial hormonal data were available, was actually a pheochromocytoma at the time of the first diagnosis but displayed a silent clinical and hormonal behaviour. The mass subsequently showed significant uptake on both 18F-FDG PET/CT and 68Ga-DOTATOC PET/CT (4, 5). It is claimed that 68Ga-DOTATOC PET/CT provides a high grade (90%) of sensitivity and specificity in the diagnosis of tumours that cause EAS (4, 5); nevertheless, a recent systematic review reported much lower sensitivity (64%), which increased to 76% in histologically confirmed cases (17).

In patients with EAS, immediate-acting steroidogenesis inhibitors are required in order to achieve prompt control of severe hypercortisolism (4). Ketoconazole is one of the drugs of choice since it inhibits adrenal steroidogenesis at several steps. In our patient, ketoconazole rapidly reduced cortisol levels to normal values, without causing hepatic toxicity (4). Moreover, ketoconazole proved effective at a moderate dosage (600 mg/day), which falls within the mean literature range (18, 19). However, dosages up to 1200–1600 mg/day are sometimes required in severe cases (usually EAS) (18, 19). Speculatively, our results might reflect an enhanced inhibitory action of ketoconazole at the adrenal level, which was able to override the strong ectopic ACTH stimulation.

In addition, the finding that, following cortisol reduction, ACTH levels paradoxically decreased suggests an additive and direct effect of the drug. This effect has been observed in a few patients with EAS (20) and is supported by in vitro studies showing a direct anti-proliferative and pro-apoptotic effect of ketoconazole on ectopic ACTH secretion by tumours (21). Finally, the reduction in ACTH levels during treatment with steroidogenesis inhibitors prompts us to postulate the presence of glucocorticoid-driven positive feedback on ACTH secretion, as already described in neuroendocrine tumours (7, 20, 21). The coexistence of EAS and ACTH-producing pituitary adenoma is very rare but must be taken into account. In our case, we deemed the pituitary mass found on MR to be a non-secreting microadenoma. This hypothesis was strengthened by the finding that, following exeresis of the ACTH-secreting pheochromocytoma, ACTH normalized, hypercortisolism vanished and pituitary function recovered. These findings suggest that: (i) altered pituitary function at the baseline was secondary to the inhibitory effect of hypercortisolism; (ii) the excessive production of cortisol was driven by ACTH overproduction outside the pituitary gland, specifically within the adrenal gland tumour.

In our patient, a few days after surgery, morning cortisol levels before hydrocortisone bolus administration were ‘normal’. Owing to both the half-life of hydrocortisone (8–12 h) and the supraphysiological dosage used, it is likely that a residual part of the drug, which cross-reacts in the cortisol assay, was still circulating at the time of blood collection, thus resulting in ‘normal’ cortisol values. Following the switch to oral cortisone, cortisol levels before therapy were low, thus confirming post-surgical hypocortisolism. Hypocortisolism remained throughout the first year after surgery, and glucocorticoid therapy was continued. Sixteen months after surgery, baseline cortisol levels returned to the normal range; cortisone therapy was therefore tapered and a further hormonal check was scheduled. Assessment of the cortisol response to ACTH stimulation testing would be helpful in order to check the resumption of the residual adrenal function.

A peculiar aspect of our case was the occurrence of a psycho-organic syndrome together with the finding of a splenial lesion on brain imaging, which was deemed secondary to metabolic injury. Indeed, the increased cortisol levels present in patients with Cushing’s disease are detrimental to the white matter of the brain, including the corpus collosum, causing subsequent clinical derangements (22).

Besides the direct effects of hypercortisolism, the splenial damage was also probably due to long-standing hypertension, worsened by newly occurring catecholamine hypersecretion and diabetes. Together with the normalization of cortisol and glycaemic levels, and of BP, a partial reduction in the splenial damage was observed on two subsequent MR examinations, and the patient’s neurological condition slowly improved until she fully recovered.

In our patient, thorough germinal genetic testing for the commonest pheochromocytoma/paraganglioma (PPGL) genes proved negative. Since approximately 40% of these tumours have germline mutations, genetic testing is recommended regardless of the patient’s age and family history. In the absence of syndromic, familial or metastatic presentation, the selection of genes for testing may be guided by the tumour location and biochemical phenotype.

Alterations of the PPGL genes can be divided into two groups: 10 genes (RET, VHL, NF1, SDHD, SDHAF2, SDHC, SDHB, SDHA, TMEM127 and MAX) that have well-defined genotype–phenotype correlations, thus allowing to tailor imaging procedures and medical management, and a group of other emerging genes, which lack established genotype–phenotype associations; for patients in whom mutations of genes belonging to this second group are detected, and hence hereditary predisposition is established, only general medical surveillance and family screening can be planned (23, 24).

In conclusion, our case highlights the importance of investigating patients with hypertension and metabolic derangements such as diabetes and hypokalaemia, since these findings may be a sign of newly occurring EAS, which, in rare cases, may be due to an ACTH-secreting pheochromocytoma. Since the additive effect of cortisol and catecholamine can cause dramatic clinical consequences, the possibility of an ACTH-secreting pheochromocytoma should be taken into account in the presence of an adrenal mass. EAS must be considered an endocrine emergency requiring urgent multi-specialist treatment. Surgery, whenever possible, is usually curative, and anatomic brain damage, as ascertained in our patient, may be at least partially reversible.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This study did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector. The study was approved by the Local Ethics Committee (no: 732/2022).

Patient consent

The patient provided written informed consent.

Author contribution statement

All authors contributed equally to the conception, writing and editing of the manuscript. L Foppiani took care of the patient during hospitalization and in the outpatient department, performed the metabolic and endocrine work-up, conceived the study, analysed the data and wrote the manuscript. MG Poeta evaluated the patient during hospitalization with regard to neurological problems and planned the related work-up (brain imaging procedures and rachicentesis). M Rutigliani analysed the histological specimens and performed immunohistochemical studies. S Parodi performed CT and MR scans and analysed the related images. U Catrambone performed the left adrenalectomy. L Cavalleri performed general anaesthesia and assisted the patient during the surgical and post-surgical periods. G Antonucci revised the manuscript. P Del Monte helped in the endocrine work-up, in the evaluation of hormonal data and in the revision of the manuscript. A Piccardo performed 18F-FDG PET/CT and analysed the related images.

Acknowledgement

The work of Prof Silvia Morbelli in performing and analysing 68Ga-DOTATOC PET/CT is gratefully acknowledged.

References

From https://edm.bioscientifica.com/view/journals/edm/2023/2/EDM22-0308.xml

 

Filed under: adrenal, Cushing's, Rare Diseases, symptoms | Tagged: , , , , | Leave a comment »

Complete and Sustained Remission of Hypercortisolism With Pasireotide Treatment of an Adrenocorticotropic Hormone (Acth)-Secreting Thoracic Neuroendocrine Tumour: an N-Of-1 Trial

Posted on February 7, 2023 by MaryO
Abstract

N-of-1 trials can serve as useful tools in managing rare disease. We describe a patient presenting with a typical clinical picture of Cushing’s Syndrome (CS).

Further testing was diagnostic of ectopic Adrenocorticotropic Hormone (ACTH) secretion, but its origin remained occult. The patient was offered treatment with daily pasireotide at very low doses (300 mg bid), which resulted in clinical and biochemical control for a period of 5 years, when a pulmonary typical carcinoid was diagnosed and dissected. During the pharmacological treatment period, pasireotide was tentatively discontinued twice, with immediate flare of symptoms and biochemical markers, followed by remission after drug reinitiation.

This is the first report of clinical and biochemical remission of an ectopic CS (ECS) with pasireotide used as first line treatment, in a low-grade lung carcinoid, for a prolonged period of 5 years. In conclusion, the burden of high morbidity caused by hypercortisolism can be effectively mitigated with appropriate pharmacological treatment, in patients with occult tumors. Pasireotide may lead to complete and sustained remission of hypercortisolism, until surgical therapy is feasible. The expression of SSTR2 from typical carcinoids may be critical in allowing the use of very low drug doses for achieving disease control, while minimizing the risk of adverse events.

 

Filed under: adrenal, Cancer, Clinical trials, Cushing's, Rare Diseases, Treatments | Tagged: , , , , , , , | Leave a comment »

Ketogenic Diet Initially Masks Symptoms of Hypercortisolism in Cushing’s Disease

Posted on November 30, 2022 by MaryO

Abstract

Cushing’s syndrome (CS) is a diagnosis used to describe multiple causes of serum hypercortisolism. Cushing’s disease (CD), the most common endogenous subtype of CS, is characterized by hypercortisolism due to a pituitary tumor secreting adrenocorticotropic hormone (ACTH). A variety of tests are used to diagnose and differentiate between CD and CS. Hypercortisolism has been found to cause many metabolic abnormalities including hypertension, hyperlipidemia, impaired glucose tolerance, and central adiposity. Literature shows that many of the symptoms of hypercortisolism can improve with a low carb (LC) diet, which consists of consuming <30 g of total carbohydrates per day. Here, we describe the case of a patient with CD who presented with obesity, hypertension, striae and bruising, who initially improved some of his symptoms by implementing a LC diet. Ultimately, as his symptoms persisted, a diagnosis of CD was made. It is imperative that practitioners realize that diseases typically associated with poor lifestyle choices, like obesity and hypertension, can often have alternative causes. The goal of this case report is to provide insight on the efficacy of nutrition, specifically a LC diet, on reducing metabolic derangements associated with CD. Additionally, we will discuss the importance of maintaining a high index of suspicion for CD, especially in those with resistant hypertension, obesity and pre-diabetes/diabetes.

1. Introduction

Cushing’s syndrome (CS) is a rare disorder of hypercortisolism related to exposure to high levels of cortisol (>20 mcg/dL between 0600–0800 or >10 mcg/dL after 1600) for an extended period [1,2]. CS affects 10 to 15 people per million and is more common among those with diabetes, hypertension, and obesity [3]. The metabolic derangements associated with CS include visceral obesity, elevated blood pressure, dyslipidemia, type II diabetes mellitus (T2DM) and insulin resistance [4]. CS physical exam findings include round face, dorsal fat pad, central obesity, abdominal striae, acne, and ecchymosis [3]. Other symptoms associated with CS include low libido, headache, change in menses, depression and lethargy [2,3,5]. The most common features of CS are weight gain, which is found in 82% of cases, and hypertension, which is found in 50–85% of cases [6]. CS can be caused by exogenous glucocorticoids, known as iatrogenic CS, ectopic ACTH secretion (EAS) from sources like a small cell lung cancer or adrenal adenoma, known as EAS CS, or excess production of ACTH from a pituitary tumor, known as CD [3]. In CD, ACTH subsequently causes increased production of cortisol from the adrenal glands. CD accounts for 80–85% of endogenous cases of CS [3]. Other conditions including alcoholism, depression, severe obesity, bulimia and anorexia nervosa can lead to a Cushing-like state, although are not considered true CS [3]. Many studies have demonstrated that LC diets can ameliorate some of the most common metabolic derangements seen in CD, namely hyperglycemia, weight gain, hypertension and insulin resistance.
A LC diet is a general term for diets which lower the total carbohydrates consumed per day [4]. A ketogenic diet is a subtype of LC that is described as having even fewer carbohydrates, typically less than 30 g/day. By reducing carbohydrate intake and thus limiting insulin production, the body achieves ketosis by producing an elevated number of ketones including β-hydroxybutyric acid, acetoacetic acid, and acetone, in the blood [7]. A carnivore diet, a specific type of a ketogenic diet, is defined as mainly eating animal food such as meat, poultry, eggs and fish. Contrarily, a standard American diet (SAD) is defined as a diet high in processed foods, carbs, added sugars, refined fats, and highly processed dairy products [8]. There are several therapeutic applications for LC diets that are currently supported by strong evidence. These include weight loss, cardiovascular disease, T2DM, and epilepsy. LC diets have clinical utility for acne, cancer, polycystic ovary syndrome (PCOS), and neurologic deficits [9].
In this case report, the patient endorsed initially starting a LC diet to address weight gain and high blood sugars that he noted on a glucometer. The patient noted a 35 pounds (lbs.) weight loss over the first 1.5 years on his LC diet, as well as improved blood pressure and in his overall health. He then adopted a carnivore diet but found that weight loss was difficult to maintain, although his body composition continued to improveand his clothes fit better. Later, he noted that his blood pressure would at times be poorly controlled despite multiple medications and strict dietary adherence. The patient reported “being in despair” and “not trusting his doctors” because they did not understand how much his diet had helped him. Despite strict adherence, his symptoms of insulin resistance and hypertension persisted. In this report, we will describe how his symptoms of CD were ameliorated by the ketogenic diet. This case report also highlights that when patients are unable to overcome hormonal pathology, clinicians should not blame patients for lack of adherence to a diet, but instead understand the need to evaluate for complex pathology.

2. Detailed Case Description

A male patient in his thirties, of Asian descent, had a past medical history of easy bruising, central obesity, headaches, hematuria, and hypertension and past family medical history of hypertension in his father and brother. In 2015, he was at his heaviest weight of 179 lbs. with a body mass index (BMI) of 28 kg/m2, placing him in the overweight category (25.0–29.9 kg/m2). At that time the patient reported he was following a SAD diet and was active throughout the day. The patient stated he ate a diet of vegetables, fruits and carbohydrates, but he was not able to lose weight. The patient stated that he switched to a LC diet, to address weight gain and hyperglycemia, and he reported that he lost approximately 35 lbs. in 1.5 years. The patient described his LC diet as eating green leafy vegetables, low carb fruits, fish, poultry, beef and dairy products. The patient then later switched to a carnivore diet. He noted despite aggressively adhering to his diet, that his weight-loss had plateaued, although his waist circumference continued to decrease. The patient noted his carnivore diet consisted of eating a variety of different meats, poultry, fish and eggs.
The metabolic markers seen in Table 1 were obtained after the patient had started a carnivore diet. The patient’s blood glucose levels decreased overtime despite impaired glucose metabolism being a known side effect of hypercortisolism [4]. The patient’s high-density lipoprotein (HDL) remained in a healthy range (40–59 mg/dL) and his triglycerides stayed in an optimal range (<100 mg/dL), despite dyslipidemia being a complication of CD [4]. When the patient was consuming a SAD diet, he was not under the care of a physician and was unable to provide us with previous biomarkers.
Table 1. Patient’s metabolic markers on a carnivore diet. Glucose (70 to 99 mg/dL), total cholesterol (desirable <200 mg/dL, borderline high 200–239 mg/dL, high >239 mg/dL), triglycerides (optimal: <100 mg/dL), HDL (low male: <40 mg/dL), low density lipoprotein (LDL) (Optimal: <100 mg/dL).
Table
Despite strict adherence to his diet and initial improvement in his weight, his blood pressure and his blood sugar levels, in October of 2021 the patient was admitted to the hospital for hypertensive urgency, with a blood pressure of 216/155. His complaints at the time were unexplained ecchymosis, hematuria and significant headaches that were resistant to Excedrin (acetaminophen-aspirin-caffeine) use. At the hospital, the patient underwent a computed tomography (CT) scan of the head and radiograph of the chest, and both images were negative for acute pathology. During his hospital admission, the patient denied any changes in vision, chest pain or edema of the legs. Ultimately, the patient was told to eat a low-salt diet and to follow-up with a cardiologist. At discharge, the patient was placed on hydrochlorothiazide, labetalol, amlodipine and lisinopril. The patient was then seen by his primary care physician in November of 2021 and his urinalysis at that time showed 30 mg/mL (Negative/Trace) of protein in his urine, without hematuria. The patient’s primary care physician discontinued his hydrochlorothiazide and started the patient on furosemide. Additionally, the primary care physician reinforced cutting out salt and limiting his calories to prevent any further weight gain, which his physician explained would contribute further to his hypertension. He was referred to hematology and oncology in November of 2021 for his symptoms of hematuria and abnormal ecchymosis to his abdomen, thighs and arms. The patient’s coagulation and platelet counts were normal, and his symptoms were noted to be improving. His hematuria and ecchymosis were attributed to his significant Excedrin use from the past 1–2 months, secondary to his headaches, and their anti-platelet effect. It was noted that the patient had significant hemolysis during his hospital admission. However, in his follow up examination, there were no signs of hemolysis, and it was attributed to his hypertensive urgency. Again, a low-salt, calorie-limited diet was recommended. The patient was referred to cardiology where he was evaluated for secondary hypertension, because despite his weight loss and his strict adherence to his diet, his blood pressure was still uncontrolled on multiple medications. He had a normal echocardiogram and renal ultrasound which showed no signs of renal artery stenosis bilaterally. At that time the patient’s serum renin, aldosterone and urine metanephrine levels were all normal. His cardiologist increased his lisinopril, and continued him on amlodipine, furosemide and labetalol and reinforced the recommendations of lowering his salt and preventing weight gain.
The patient first contacted our office in January of 2022. At that time his blood pressure was noted to be 160/120 despite being compliant with current blood pressure medications. The patient reported strict adherence to his carnivore diet by sharing his well-documented meals on his social media accounts. Given the persistent symptoms, despite his significant change in diet and weight loss, we were concerned that a hormonal etiology may be driving his symptoms. The patient was seen in-person, in our office, in March of 2022. At the request of the patient, we again reviewed his social media profile to assess his meal choices and diet. While the patient was eager to show us his carnivore meals, what we incidentally noted in his photos was despite weight loss and strict diet adherence, he had developed moon facies (Figure 1a,b). On the physical exam, we noted his prominent abdominal striae (Figure 2). Several screening tests for Cushing’s syndrome were ordered. A midnight salivary cortisol was ordered, with values of 0.884 ug/dL (<0.122 ug/dL) and 0.986 ug/dL (<0.122 ug/dL) and a urinary free cortisol excretion (UFC) was ordered, with values of 8.8 ug/L (5–64 ug/L). At this point our suspicion was confirmed that the patient had inappropriately elevated cortisol.
Metabolites 12 01033 g001 550
Figure 1. The patient’s progression of moon facies, (a) photo from 2019 after initial weight loss (b) photo from office visit in 2022.
Metabolites 12 01033 g002 550
Figure 2. The arrows demonstrate early striae visualized on the lower abdomen bilaterally, unclear in image due to poor office lighting.
Based on screening tests and significant physical exam findings, we referred the patient to endocrinology for a low dose dexamethasone suppression test (DST). They performed a low dose DST revealing a dehydroepiandrosterone (DHEA) of 678 ug/dL (89–427 ug/dL) and ACTH of 23.9 pg/mL (7.2–63.3 pg/mL). The low dose DST and midnight salivary cortisol were both positive indicating hypercortisolism. To begin determining the source of hypercortisolism, the plasma ACTH was evaluated and was 27.2 pg/mL (7.2–63.3 pg/mL). While ACTH was within normal range, a plasma ACTH > 20 pg/mL is suggestive of ACTH-dependent CS, so a magnetic resonance imaging (MRI) of the brain was ordered [2]. The MRI revealed a 4 mm heterogeneous lesion in the central pituitary gland which is suspicious of a cystic microadenoma. To confirm that a pituitary tumor was the cause of the patient’s increased cortisol, the patient was sent for inferior petrosal sinus sampling (IPSS). The results of the IPSS indicated an increase in ACTH in both inferior petrosal sinuses and peripheral after corticotropin-releasing hormone (CRH) stimulation (Figure 3a–c), which was consistent with hypercortisolism.
Metabolites 12 01033 g003a 550Metabolites 12 01033 g003b 550
Figure 3. (a) Right IPS venous sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals. (b) Left IPS venous sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals. (c) Peripheral sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals.
Lab results from the patient’s IPSS venous sampling can be seen above. The graphs depict the lab values of ACTH (7.2–63.3 pg/mL) and prolactin (PRL) (2.1–17.7 ng/mL) before and after CRH stimulation during IPSS. PRL acts as a baseline to indicate successful catheterization in the procedure [10].
Using the ACTH levels from our patient’s IPSS we calculated a ratio of inferior petrosal sinus to peripheral (IPS:P). These results can be seen below (Table 2). The right IPS:P was calculated as 3.60 at 10 min and the left IPS:P as 7.65 at 10 min. These ratios confirmed that the hypercortisolism was due to the pituitary tumor, as it is higher than the 3:1 ratio necessary for diagnosis of CD [11]. The patient is currently scheduled to undergo surgical resection of the pituitary microadenoma.
Table 2. Right and left petrosal sinus to peripheral serum ACTH ratios.
Table

3. Clinical Evaluation for CS

In this case, the patient presented with uncontrolled hypertension, weight gain despite a strict diet, hyperglycemia, abdominal striae and moon facies. Despite evaluation, both inpatient and outpatient, a diagnosis of CS was not yet explored. When CS is suspected based on clinical findings, the use of exogenous steroids must first be excluded as it is the most common cause of hypercortisolism [3]. If there is still concern for CS, there are three screening tests that can be done which are sensitive but not specific for hypercortisolism. The screening tests include: a 24-h UFC, 2 late night salivary cortisol tests, low dose (1 g) DST [3]. To establish the preliminary diagnosis of hypercortisolism two screening tests must be abnormal [2].
The first step to determine the cause of hypercortisolism is to measure the plasma level of ACTH. Low values of ACTH < 5 pg/mL indicate the cause is likely ACTH-independent CS and imaging of the adrenal glands is warranted as there is a high suspicion of an adrenal adenoma [2,3]. When the serum ACTH is elevated >/20 pg/mL it is likely an ACTH-dependent form of CS [2]. To further evaluate an ACTH-dependent hypercortisolism, an MRI should be obtained as there is high suspicion that the elevated cortisol is coming from a pituitary adenoma. If there is a pituitary mass >6 mm there is a strong indication for the diagnosis of CD [2]. However, pituitary tumors can be quite small and can be missed on MRIs in 20–58% of patients with CD [2]. If there is still a high suspicion of CD with an inconclusive MRI, a high dose DST (8 g) is done. Patients with CD should not respond and their ACTH and DHEA, a steroid precursor, should remain high. Similarly, CRH stimulation test is done and patients with CD should have an increase in ACTH and/or cortisol within 45 min of CRH being given. If the patient has a positive high-dose DST, CRH-stimulation test and an MRI with a pituitary tumor >6 mm no further testing is needed as it is likely the patient has CD [2]. If either of those tests are abnormal, the MRI shows a pituitary tumor < 6 mm, or there is diagnostic ambiguity, the patient should undergo IPSS with ACTH measurements before and after the administration of CRH [4]. IPSS is the gold standard for determining the source of ACTH secretion and confirming CD. In this invasive procedure, ACTH, prolactin, and cortisol levels are sampled prior to CRH stimulation and after CRH stimulation. PRL acts as a baseline to indicate successful catheterization in the procedure [12]. To confirm CD, a ratio of IPS:P is calculated for values prior to and after CRH stimulation. A peak ratio greater than 2.0 before CRH stimulation or a peak ratio greater than 3.0 after CRH stimulation is indicative of CD. In comparing the right and left petrosal sinus sample, an IPS:P ratio greater than 1.4 suggests adenoma lateralization. However, due to high variability, IPSS should not be used for diagnosing lateralization [13].

4. Discussion

Surgical intervention remains the primary treatment for CD [4]. However, remission is not guaranteed as symptoms and metabolic diseases have been shown to persist afterwards. In the literature it has been shown that nutrition can have a powerful impact on suppressing, or even reversing metabolic disorders and comorbidities associated with CD. A LC diet has been shown to promote significant weight loss, reduce hypertension, improve dyslipidemia, reverse T2DM and improve cortisol levels (2, 14–15, 18–21).
There are reports of weight loss on a LC diet in the literature. A LC significantly reduced weight and BMI of 30 male subjects [14]. In a group of 120 participants over 24 weeks who followed a LC versus low fat (LF) diet, showed a greater weight loss in the LC group vs. the LF group [15]. Patients diagnosed and treated for CD found that their weight remained largely unchanged even after treatment [6]. In many cases, surgical treatment does not always resolve the associated comorbidity of central adiposity in CD. In such cases, a LC diet can be used before, during and after treatment, as an adjunct, to decrease associated weight gain and comorbidities.
Nutritional intervention can be a powerful adjunct to reduce comorbidities associated with CD. As seen in this case report, the patient’s symptoms of CD, especially hypertension and weight gain, improved with dietary changes despite him having a pituitary microadenoma. Multiple studies showed that a LC diet was able to decrease blood pressure parameters. In a group of 120 participants over 24 weeks who followed a LC versus a LF diet showed a greater decrease in both systolic and diastolic blood pressure in the LC group vs. the LF group [15]. Other literature which studied the effect of a LC diet on hypertension demonstrated the reduction of blood pressure and is thought to be due to ketogenesis. It is thought the production of ketones have a natriuretic effect on the body therefore lowering systemic blood pressure [16].
A LC diet improves lipid profiles and inflammatory markers associated with metabolic syndrome [14]. Literature shows that a LC diet has a greater impact on decreasing triglyceride levels and increasing HDL levels, when compared to a LF diet [15]. Triglyceride levels in patients in CD remission remained high [17]. Therefore, it can be hypothesized that a LC diet would be beneficial, in addition to standard CD treatment, to lower the associated comorbidity of hypertriglyceridemia and metabolic syndrome.
Insulin resistance, a precursor to T2DM, is a common comorbidity of hypercortisolism which can be treated with a LC diet. One study showed that in subjects with T2DM, a decrease in A1c and a reduction in antidiabetic therapy were seen with consumption of a LC diet [18]. Additionally, a cohort of 9 participants following a LC diet were able to collectively lower their A1c on average by 1% while concurrently discontinuing various antidiabetic therapies including insulin [19].
Literature shows that a LC diet can minimize systemic cortisol levels through various mechanisms. Current treatment of CD includes medications which block cortisol production and/or cortisol secretion [2]. LC can imitate similar results seen through medication intervention for CD. Carbohydrate restriction can lower cortisol levels, as carbohydrates stimulate adrenal cortisol secretion and extra-adrenal cortisol regeneration [4]. A ketogenic diet can lower the level of ghrelin, a peptide produced in the stomach that has orexigenic properties [20,21]. Literature shows that ghrelin increases levels of serum cortisol [22]. Therefore, implementing a ketogenic diet would decrease ghrelin, and subsequently minimize the effects of increased ghrelin on serum cortisol. A LC diet decreases visceral fat which itself is an endocrine organ and can increase the synthesis of cortisol [14]. Therefore, decreasing visceral fat also decreases the production of cortisol. A LC was shown to significantly reduced weight, BMI and cortisol levels of 30 obese male subjects [14]. Further, a LC diet excludes foods with a high glycemic index which cause increased stress on the body which subsequently leads to the activation of the hypothalamic-pituitary-axis which causes increased levels of cortisol [14].
This case report illustrated how a LC diet was initially successful at ameliorating the patient’s associated symptoms of hypertension and obesity, making his diagnosis of CD go undetected. Literature shows that while the prevalence of CS on average is a fraction of a percent, it is much higher among patients with poorly controlled diabetes, hypertension and early onset osteoporosis [3]. Two hundred patients with diabetes mellitus were studied and 5.5% were found to have CS [23]. Another study discovered that in subjects with CD, 36.4% were found to have hyperlipidemia, 73.1% with hypertension, and 70.2% with impaired glucose metabolism [17]. It can be concluded that a higher index of suspicion and lower threshold for screening for CS may be necessary in obese and diabetic patient populations. A lower threshold for screening can allow for earlier diagnosis for many patients, and therefore provide better outcomes for those diagnosed with CS.
It is important for clinicians to consider alternative pathology for patients combating metabolic derangements. As depicted in this case, the patient lost 35 lbs. while on a LC diet, despite having hypercortisolism, presumably for months to years prior to the diagnosis of his condition. The patient noted a tendency to gain weight, have elevated blood sugar and blood pressure which prompted him to begin self-treatment with increasingly strict carbohydrate restriction. The patient was able to keep his symptoms of hypercortisolism managed, potentially making the diagnosis difficult for his team of clinicians. From a diagnostic perspective, it’s important to understand that strict dietary adherence can have profound impacts on even the most severe hormonal pathology. Ultimately, this case serves as a reminder of the power of nutrition to address metabolic derangements and simultaneously as a reminder to diagnosticians to never rely on lack of dietary adherence as a reason for persistent metabolic symptoms. The reflexive advice to “not gain weight” and “lower salt intake” in retrospect appears both dogmatic and careless. In this case, the patient had seen several doctors and was even hospitalized and yet his disease state remained unclear and the dietary messaging cursory.

5. Conclusions

Many chronic diseases, including diabetes, hypertension and obesity, are generally thought to be caused by dietary and lifestyle choices. However, as exemplified in this report underlying medical problems, such as endocrine disorders, can be the cause of such metabolic derangements. It is critical that practitioners consider other causes of metabolic derangements, as assuming that they are due to poor dietary adherence, can allow them to go undiagnosed. While there is extensive literature on LC diets and their effect on the metabolic derangements associated with hypercortisolism, there needs to be further research on LC as an adjunctive therapy to conventional CD treatment. Ultimately, nutrition can have a powerful impact on suppressing, or even reversing metabolic disorders. As depicted in this case study, a LC diet is powerful enough to temporarily suppress symptoms of CD.

Author Contributions

M.K.D., E.-C.P.-M. and T.K. equally contributed to this case report. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Written informed consent has been obtained from the patient to publish this paper.

Data Availability Statement

The data presented in this study are available in article.

Acknowledgments

We would like to thank our patients and the Society of Metabolic Health Practitioners.

Conflicts of Interest

T.K. is an unpaid member of the Board of Directors of the Society of Metabolic Health Practitioners and a producer of podcasts on health and nutrition, with all proceeds donated to humanitarian charities; his spouse has ownership interest in a food company. The other author reports no conflicts of interest.

References

  1. Nieman, L.K. UpToDate. Available online: https://www.uptodate.com/contents/measurement-of-cortisol-in-serum-and-saliva?search=cortisol%20level&source=search_result&selectedTitle=1~150&usage_type=default&display_rank=1 (accessed on 27 September 2022).
  2. Feelders, R.; Sharma, S.; Nieman, L. Cushing’s Syndrome: Epidemiology and Developments in Disease Management. Clin. Epidemiol. 2015, 7, 281. [Google Scholar] [CrossRef] [PubMed]
  3. Guaraldi, F.; Salvatori, R. Cushing Syndrome: Maybe Not so Uncommon of an Endocrine Disease. J. Am. Board Fam. Med. 2012, 25, 199–208. [Google Scholar] [CrossRef] [PubMed]
  4. Guarnotta, V.; Emanuele, F.; Amodei, R.; Giordano, C. Very Low-Calorie Ketogenic Diet: A Potential Application in the Treatment of Hypercortisolism Comorbidities. Nutrients 2022, 14, 2388. [Google Scholar] [CrossRef] [PubMed]
  5. Nieman, L.K. UpToDate. Available online: https://www.uptodate.com/contents/epidemiology-and-clinical-manifestations-of-cushings-syndrome?search=cushings%20diagnosis%20symptoms&source=search_result&selectedTitle=2~150&usage_type=default&display_rank=2 (accessed on 27 September 2022).
  6. Schernthaner-Reiter, M.H.; Siess, C.; Gessl, A.; Scheuba, C.; Wolfsberger, S.; Riss, P.; Knosp, E.; Luger, A.; Vila, G. Factors Predicting Long-Term Comorbidities in Patients with Cushing’s Syndrome in Remission. Endocrine 2018, 64, 157–168. [Google Scholar] [CrossRef] [PubMed]
  7. Giordano, C.; MarchiÃ2, M.; Timofeeva, E.; Biagini, G. Neuroactive Peptides as Putative Mediators of Antiepileptic Ketogenic Diets. Front. Neurol. 2014, 5, 63. [Google Scholar] [CrossRef]
  8. Standard American Diet (SAD). Available online: https://piviohealth.com/knowledge-bank/glossary/standard-american-diet-sad/ (accessed on 2 October 2022).
  9. Paoli, A.; Rubini, A.; Volek, J.S.; Grimaldi, K.A. Beyond Weight Loss: A Review of the Therapeutic Uses of Very-Low-Carbohydrate (Ketogenic) Diets. Eur. J. Clin. Nutr. 2013, 67, 789–796. [Google Scholar] [CrossRef] [PubMed]
  10. Sharma, S.T.; Nieman, L.K. Is Prolactin Measurement of Value during Inferior Petrosal Sinus Sampling in Patients with ACTH-Dependent Cushing’s Syndrome? J. Endocrinol. Investig. 2013, 36, 1112–1116. [Google Scholar] [CrossRef]
  11. Kline, G.; Chin, A.C. Chapter 5—Adrenal disorders. In Endocrine Biomarkers: Clinical Aspects and Laboratory Determination; Elsevier: Amsterdam, The Netherlands, 2017; Available online: https://www.sciencedirect.com/science/article/pii/B9780128034125000057 (accessed on 18 October 2022).
  12. Ghorbani, M.; Akbari, H.; Griessenauer, C.J.; Wipplinger, C.; Dastmalchi, A.; Malek, M.; Heydari, I.; Mollahoseini, R.; Khamseh, M.E. Lateralization of Inferior Petrosal Sinus Sampling in Cushing’s Disease Correlates with Cavernous Sinus Venous Drainage Patterns, but Not Tumor Lateralization. Heliyon 2020, 6, e05299. [Google Scholar] [CrossRef]
  13. Knecht, L. Inferior Petrosal Sinus Sampling in the Diagnosis of Cushing’s Disease. Available online: https://csrf.net/doctors-articles/inferior-petrosal-sinus-sampling-diagnosis-cushings-disease/ (accessed on 18 October 2022).
  14. Polito, R.; Messina, G.; Valenzano, A.; Scarinci, A.; Villano, I.; Monda, M.; Cibelli, G.; Porro, C.; Pisanelli, D.; Monda, V.; et al. The Role of Very Low Calorie Ketogenic Diet in Sympathetic Activation through Cortisol Secretion in Male Obese Population. J. Clin. Med. 2021, 10, 4230. [Google Scholar] [CrossRef] [PubMed]
  15. Yancy, W.S.; Olsen, M.K.; Guyton, J.R.; Bakst, R.P.; Westman, E.C. A Low-Carbohydrate, Ketogenic Diet versus a Low-Fat Diet to Treat Obesity and Hyperlipidemia. Ann. Intern. Med. 2004, 140, 769. [Google Scholar] [CrossRef] [PubMed]
  16. Khan, S.S.; Ning, H.; Wilkins, J.T.; Allen, N.; Carnethon, M.; Berry, J.D.; Sweis, R.N.; Lloyd-Jones, D.M. Association of Body Mass Index with Lifetime Risk of Cardiovascular Disease and Compression of Morbidity. JAMA Cardiol. 2018, 3, 280–287. [Google Scholar] [CrossRef]
  17. Sun, X.; Feng, M.; Lu, L.; Zhao, Z.; Bao, X.; Deng, K.; Yao, Y.; Zhu, H.; Wang, R. Lipid Abnormalities in Patients with Cushing’s Disease and Its Relationship with Impaired Glucose Metabolism. Front. Endocrinol. 2021, 11, 600323. [Google Scholar] [CrossRef] [PubMed]
  18. Bolla, A.; Caretto, A.; Laurenzi, A.; Scavini, M.; Piemonti, L. Low-Carb and Ketogenic Diets in Type 1 and Type 2 Diabetes. Nutrients 2019, 11, 962. [Google Scholar] [CrossRef] [PubMed]
  19. Norwitz, N.G.; Soto-Mota, A.; Kalayjian, T. A Company Is Only as Healthy as Its Workers: A 6-Month Metabolic Health Management Pilot Program Improves Employee Health and Contributes to Cost Savings. Metabolites 2022, 12, 848. [Google Scholar] [CrossRef] [PubMed]
  20. Ebbeling, C.B.; Feldman, H.A.; Klein, G.L.; Wong, J.M.W.; Bielak, L.; Steltz, S.K.; Luoto, P.K.; Wolfe, R.R.; Wong, W.W.; Ludwig, D.S. Effects of a Low Carbohydrate Diet on Energy Expenditure during Weight Loss Maintenance: Randomized Trial. BMJ 2018, 363, k4583. [Google Scholar] [CrossRef] [PubMed]
  21. Marchiò, M.; Roli, L.; Lucchi, C.; Costa, A.M.; Borghi, M.; Iughetti, L.; Trenti, T.; Guerra, A.; Biagini, G. Ghrelin Plasma Levels after 1 Year of Ketogenic Diet in Children with Refractory Epilepsy. Front. Nutr. 2019, 6, 112. [Google Scholar] [CrossRef] [PubMed]
  22. Kärkkäinen, O.; Farokhnia, M.; Klåvus, A.; Auriola, S.; Lehtonen, M.; Deschaine, S.L.; Piacentino, D.; Abshire, K.M.; Jackson, S.N.; Leggio, L. Effect of Intravenous Ghrelin Administration, Combined with Alcohol, on Circulating Metabolome in Heavy Drinking Individuals with Alcohol Use Disorder. Alcohol. Clin. Exp. Res. 2021, 45, 2207–2216. [Google Scholar] [CrossRef] [PubMed]
  23. Catargi, B.; Rigalleau, V.; Poussin, A.; Ronci-Chaix, N.; Bex, V.; Vergnot, V.; Gin, H.; Roger, P.; Tabarin, A. Occult Cushing’s Syndrome in Type-2 Diabetes. Available online: https://academic.oup.com/jcem/article/88/12/5808/2661485 (accessed on 27 September 2022).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Filed under: Cushing's, pituitary, Rare Diseases, symptoms | Tagged: , , , , , , | Leave a comment »

Recurrent Neuroendocrine Tumor of the Cervix Presenting With Ectopic Cushing’s Syndrome

Posted on November 28, 2022 by MaryO

​

Abstract

Neuroendocrine carcinomas (NEC) of the cervix are a rare disease entity and account for only 1-2% of cervical carcinomas. The small-cell variant is the most common, with a worse prognosis and a higher rate of lymphatic and hematogenous metastases when compared with other subtypes of NEC. The diagnosis is usually made when the extra-pelvic disease is already apparent. Cushing’s syndrome due to adrenocorticotropic hormone (ACTH)-secreting tumors of the cervix is exceedingly rare. To date, there have been no reported cases in the literature of Cushing’s syndrome induced by the recurrence of metastases years after the initial diagnosis. This is a case of recurrent small-cell neuroendocrine carcinoma of the cervix presenting with Cushing’s syndrome five years after her original diagnosis. We present here the workup, management, and follow-up of this patient, including multisystemic, coordinated medical care.

Introduction

Neuroendocrine carcinomas (NECs) are heterogenous groups of tumors derived from neuroendocrine cells. NECs of the cervix are rare and account for 1-2% of all cervical carcinomas, with the small-cell variant being the most common [1,2]. Small-cell NECs have a high rate of lymphatic and hematogenous metastasis even when the carcinoma is limited to the cervix. Patients usually present at a late stage, with the extra-pelvic disease being apparent at the time of diagnosis [2]. Among the different histologic variants of NEC of the cervix, the small-cell variant has the highest rate of recurrence [3]. Adrenocorticotropic hormone (ACTH)-secreting tumors of the cervix are rare [4]. We present a case of recurrent metastatic NEC of the cervix five years after the original diagnosis of NEC of the cervix, now presenting with Cushing’s syndrome [1,2].

Case Presentation

A 39-year-old female with a history of recurrent small-cell cervical cancer presented to the emergency department (ED) of our hospital with complaints of weight gain, generalized facial edema, lightheadedness, tingling sensation of her entire face, bilateral leg edema, and abdominal distention.

Her problems started a month prior to her ED visit, when she started to complain of abdominal distention. She had a computed tomography (CT) abdomen with contrast, which revealed evidence of metastatic disease, including multiple large liver lesions (Figure 1). Subsequently, she had a positron emission tomography (PET) scan, which confirmed the presence of hypermetabolic lesions in the right peritonsillar tissue, liver, right lower quadrant of the abdomen, and bilateral pulmonary nodules with lymphadenopathy in the left hilum (Figure 2). A liver biopsy was done, with the final pathology consistent with recurrent NEC of the cervix. She was started on cisplatin, etoposide, and atezolizumab by gynecologic oncology but started to develop facial swelling and progressive abdominal distention, prompting this ED consult and subsequent admission.

Abdomial-CT-with-contrast-done-one-month-prior-showed-evidence-of-metastatic-disease-including-multiple-large-liver-lesions.
Figure 1: Abdomial CT with contrast done one month prior showed evidence of metastatic disease including multiple large liver lesions.
PET/CT-demonstrated-the-presence-of-hypermetabolic-lesions-in-the-liver-and-right-lower-quadrant-of-the-abdomen.
Figure 2: PET/CT demonstrated the presence of hypermetabolic lesions in the liver and right lower quadrant of the abdomen.

She had a significant medical history of being diagnosed with cervical cancer (FIGO stage 1B2 NEC) five years prior by gynecologic oncology, at which time she underwent concurrent chemo-radiation followed by surgical assessment of her pelvic lymph nodes with robotic pelvic lymph node dissection and bilateral ovarian transposition to avoid premature menopause. She was subsequently treated with cisplatin and pelvic radiation. She had a follow-up cervical biopsy several months after chemotherapy, which showed persistent NEC, but her PET scan showed no evidence of metastatic disease. After undergoing a robotic total laparoscopic hysterectomy, the final pathology showed a persistent microscopic focus of NEC of the cervix with negative margins. She received adjuvant chemotherapy with cisplatin and etoposide for six cycles with regular follow-up pap smears and annual PET scans, with no evidence of recurrence for five years.

On admission, her vital signs were: blood pressure = 129/79 mm Hg, pulse rate = 85/min, respiratory rate = 18/min, and temperature = 98.5 °F (36.9 °C). Her physical examination was notable for moon facies (a noticeable change from her pictures as recent as two months prior), supraclavicular and dorsocervical fat pads, multiple bruises on her arms, edema of her face and legs, acne of her face and neck, and hair growth of her chin area. No purple striae were seen on the abdomen.

Laboratory tests revealed leukopenia and thrombocytopenia (which were attributed to her chemotherapy), recently diagnosed diabetes (occasional hyperglycemia and HbA1c 7.7%), and electrolyte imbalances (hypokalemia and hypophosphatemia) (Table 1).

Sodium 142 mEq/L (135–145 mEq/L)
Potassium 2.0 mEq/L (3.5–5.0 mEq/L)
Chloride 98 mEq/L (98–108 mEq/L)
CO2 35 mEq/L (21–32 mEq/L)
Anion gap 9 mEq/L (8–16 mEq/L)
BUN 14 mg/dL (7–13 mEq/L)
Creatinine 1.13 mg/dL (0.6–1.1 mg/dL)
Glucose 460 mg/dL (74–100 mg/dL)
Calcium 7.8 mg/dL (8.5–10.1 mg/dL)
Phosphorous 1.0 mg/dL (2.5–4.5 mg/dL)
Albumin 2.5 mg/dL (3.1–4.5 mg/dL)
AST 43 U/L (15–27 U/L)
ALT 76 U/L (12–78 U/L)
White blood cell count 0.6 k/cmm (4.5–10.0 k/cmm)
Red blood cell count 3.55 million cells/μL (3.7–5 × 2)
Hemoglobin 11.9 g/dL (12.0–16.0)
Hematocrit 34.3% (35.0–47.0)
Platelet 45 k/cmm (150–440 k/cmm)
Table 1: Initial laboratory work showed leukopenia, thrombocytopenia, hyperglycemia, hypokalemia, and hypophosphatemia.

AST: aspartate aminotransferase, CO2: carbon dioxide, BUN: blood urea nitrogen, ALT: alanine aminotransferase.

Her chest X-ray showed bilateral pleural effusions. Magnetic resonance imaging (MRI) of the brain showed no evidence of pituitary masses, abnormalities, or metastatic disease in the brain. A CT of the chest showed new bilateral non-calcified lung nodules when compared to the previous PET scan, pathologic-sized left hilar adenopathy, and multiple peripherally enhancing hepatic nodules and masses (Figure 3). The adrenal glands were unremarkable. Workup for facial swelling and bilateral leg edema showed no evidence of superior vena cava (SVC) syndrome on both her chest CT and transthoracic echocardiogram.

Contrast-enhanced-chest-CT-showing-bilateral-noncalcified-lung-nodules.
Figure 3: Contrast-enhanced chest CT showing bilateral noncalcified lung nodules.

She was admitted to the intensive care unit (ICU) and started on empiric antibiotics and filgrastim for neutropenia. Replacement therapy for both hypokalemia and hypophosphatemia was given. After both electrolytes were normalized, the patient was started on basal-bolus insulin therapy.

Based on her clinic presentation of excessive weight gain, new-onset hyperglycemia, hypertension with hypokalemia, and a history of NEC, suspicion of Cushing’s syndrome was high. Further workup showed elevated serum cortisol after 1 mg overnight dexamethasone suppression, elevated 24-hour urine cortisol, and elevated midnight salivary cortisol, which confirmed Cushing’s syndrome (Table 2). ACTH was also elevated, but dehydroepiandrosterone sulfate (DHEAS) was normal. Thyroid function tests showed a slightly low free thyroxine, but this was attributed to an acute illness.

HgbA1C 7.7% (4.0-6.0%)
ACTH 1207 pg/mL (7.2–63.3 pg/mL)
24-hour urine cortisol 7070 μg/24 hr (6–42 μg/24 hr)
Salivary cortisol >1.000 μg /dL (0.025–0.600 μg/dL)
Serum cortisol after 1 mg overnight dexamethasone suppression 143.0 μg/dL (3.1–16.7 μg/dL)
Total testosterone 77 ng/dL (14–76 ng/dL)
DHEAS 250.0 μg/dL (57.3–279.2 μg/dL)
Chromogranin A 970.9 ng/mL (0.0–101.8 ng/mL)
TSH 0.572 mIU/L (0.358–3.74mIU/L)
Free T4 0.70 ng/dl (0.76–1.46) ng/dl
Table 2: Work up showed elevated ACTH, elevated 24-hour urine cortisol, elevated salivary cortisol, and elevated serum cortisol after 1 mg overnight dexamethasone suppression test.

HgbA1C: hemoglobin A1C; ACTH: adrenocorticotropic hormone; DHEAS: dehydroepiandrosterone sulfate; TSH: thyroid stimulating hormone; free T4: free thyroxine.

A diagnosis of Cushing’s syndrome due to metastatic small-cell neuroendocrine carcinoma of the cervix was assumed. A bilateral adrenalectomy, which is the definitive treatment of hypercortisolism when surgical removal of the source of excess ACTH is done, was not done because gynecologic oncology wanted to treat her with chemotherapy urgently due to her metastases and the nature of the disease and felt that surgery and recovery would delay the start of chemotherapy. Ketoconazole was felt to be a poor choice in the setting of liver metastases with worsening liver function tests. The patient was thus started on mifepristone 300 mg daily, as it is indicated for hypercortisolism secondary to endogenous Cushing’s syndrome with diabetes. Nephrology was consulted, and potassium supplementation was transitioned to oral potassium chloride 40 meq tablets four times a day; spironolactone 50 mg twice daily was added for the hypokalemia and hypertension, which occurred after the patient started bevacizumab. Hypokalemia is a common side effect of mifepristone therapy due to the glucocorticoid receptor blockade, which leads to cortisol’s spillover effect on unopposed mineralocorticoid receptors. She was discharged home with a basal-bolus insulin regimen.

Her posthospitalization course was complicated by compression fractures of her lumbar spine one week after discharge with no history of falls. An MRI of the spine showed chronic compression fractures of the T11-L3 vertebral bodies with no evidence of osseous metastatic disease. Dual-energy X-ray absorptiometry (DXA) scan interpretation demonstrated osteoporosis. Vertebral fracture assessment showed morphometric fractures in the lower thoracic and upper lumbar vertebrae. She was subsequently treated with IV administration of 5 mg of zoledronic acid. She was also readmitted multiple times after her initial admission due to the patient’s developing neutropenic fever, which was treated with filgrastim and antibiotics.

After starting mifepristone, her glycemic control improved to the point that insulin therapy could be subsequently discontinued. Her liver enzymes normalized, and ketoconazole was subsequently added for adjunct therapy to treat hypercortisolism, but the dose could not be optimized due to persistently elevated liver function tests. Hypokalemia management and resistant hypertension were additional challenges encountered by this patient.

At her follow-up visits, she had notably lost weight with the improvement of her leg edema. She continued to follow up with a nephrologist on an outpatient basis, and her normal potassium levels were normal on 40 meq of oral potassium chloride tablets four times a day and spironolactone 150 mg twice a day. She was followed up closely by her gynecologic oncologist and was on bevacizumab, topotecan, and paclitaxel before her unfortunate demise a few months later.

Discussion

Cushing’s syndrome due to ectopic ACTH secretion only represents 9-18% of cases. Most primary endocrine tumors responsible for ectopic ACTH secretion are located in the chest [5]. Abdominal and retroperitoneal neuroendocrine tumors are the second- and third-most reported sites [5]. Neuroendocrine tumors of the cervix are incredibly rare [6-9].

A unique feature of this case is that the patient presented with Cushing’s syndrome due to neuroendocrine tumor metastases found five years after the primary site of the tumor was resected. For this patient, a biopsy of the liver confirmed a metastatic neuroendocrine tumor, but it is unknown if the other sites of metastases are implicated in the production of excess ACTH.

The management of this disease focuses on controlling hypercortisolism, consequent hyperglycemia, and hypokalemia. Surgical excision of ACTH-secreting neuroendocrine tumors is the most effective, but in cases where that is not possible, bilateral adrenalectomy and medical treatment are the next best treatments for this disease entity [10]. For this patient, bilateral adrenalectomy was not done as gynecologic oncology wanted to treat her with chemotherapy urgently due to the metastases and nature of the disease and felt that surgery and recovery would delay the start of chemotherapy.

We provided medical management for the patient’s hypercortisolism. Pharmacological therapy for hypercortisolism can be categorized into immediate-acting steroidogenesis inhibitors (metyrapone, ketoconazole, and etomidate), slow-acting cortisol-lowering drugs (mitotane), and glucocorticoid receptor antagonists (mifepristone) [5]. We initially chose mifepristone because it is indicated in patients with type 2 diabetes mellitus and could be given safely despite the patient’s worsening liver function levels [11].

As demonstrated, the management of recurrent hypokalemia proved challenging in this patient. The phenomenon is well known to be induced by ectopic ACTH. Several mechanisms contribute to this. Activation of renal tubular type 1 (mineralocorticoid) receptors by cortisol is thought to be the mechanism that applies mainly to patients with severe hypercortisolism due to ectopic ACTH secretion. Additionally, there may also be an increase in the production of renin substrate from the liver. The high serum cortisol concentrations may not be completely inactivated by 11β-hydroxysteroid dehydrogenase type 2 in the kidney and overwhelm its ability to convert cortisol to cortisone, resulting in activation of mineralocorticoid receptors resulting in potassium loss in the distal tubules [12]. Hypokalemia may also result from adrenal hypersecretion of mineralocorticoids, such as deoxycorticosterone and corticosterone. This can also be amplified by mifepristone, as it is a glucocorticoid receptor antagonist that increases circulating cortisol levels [12].

Complications such as hypokalemia, hyperglycemia, acute respiratory distress syndrome, infections, muscle wasting, hypertension, and bone fractures can occur and can arise at any time throughout the course of the disease when urine-free cortisol is fivefold or more above the upper limit of normal [5]. Ketoconazole was initially considered for medical treatment, but due to mildly elevated liver enzymes during the initial presentation, we decided to use mifepristone instead. A small cohort study showed that severe hypercortisolism and increased baseline transaminase levels could be due to cortisol-induced hepatic steatosis [13]. Later in her course, ketoconazole was added to her mifepristone therapy to decrease adrenal cortisol production. Unfortunately, her dose could not be increased due to the patient’s persistently elevated liver enzymes.

Recurrent pancytopenia due to chemotherapy contributed to the protracted nature of this patient’s clinical course. Due to cortisol’s immunosuppressive and anti-inflammatory effects, opportunistic infections can arise [14]. Since her initial hospitalization, she has been readmitted several times due to neutropenic fever, which was treated with filgrastim and antibiotics.

Conclusions

Ectopic Cushing’s syndrome due to metastatic neuroendocrine small-cell carcinoma is a rare condition with a poor prognosis. The options for treatment are few and not necessarily curative. There needs to be increased awareness of this serious and rare complication. Managing the condition can be a challenge and requires a multidisciplinary team approach to improve outcomes.

References

  1. Cohen JG, Kapp DS, Shin JY, et al.: Small cell carcinoma of the cervix: treatment and survival outcomes of 188 patients. Am J Obstet Gynecol. 2010, 203:347.e1-6. 10.1016/j.ajog.2010.04.019
  2. Salvo G, Gonzalez Martin A, Gonzales NR, Frumovitz M: Updates and management algorithm for neuroendocrine tumors of the uterine cervix. Int J Gynecol Cancer. 2019, 29:986-95. 10.1136/ijgc-2019-000504
  3. Stecklein SR, Jhingran A, Burzawa J, Ramalingam P, Klopp AH, Eifel PJ, Frumovitz M: Patterns of recurrence and survival in neuroendocrine cervical cancer. Gynecol Oncol. 2016, 143:552-7. 10.1016/j.ygyno.2016.09.011
  4. Chen J, Macdonald OK, Gaffney DK: Incidence, mortality, and prognostic factors of small cell carcinoma of the cervix. Obstet Gynecol. 2008, 111:1394-402. 10.1097/AOG.0b013e318173570b
  5. Young J, Haissaguerre M, Viera-Pinto O, Chabre O, Baudin E, Tabarin A: Management of Endocrine Disease: Cushing’s syndrome due to ectopic ACTH secretion: an expert operational opinion. Eur J Endocrinol. 2020, 182:R29-58. 10.1530/EJE-19-0877
  6. Hashi A, Yasumizu T, Yoda I, et al.: A case of small cell carcinoma of the uterine cervix presenting Cushing’s syndrome. Gynecol Oncol. 1996, 61:427-31. 10.1006/gyno.1996.0168
  7. Iemura K, Sonoda T, Hayakawa A, et al.: Small cell carcinoma of the uterine cervix showing Cushing’s syndrome caused by ectopic adrenocorticotropin hormone production. Jpn J Clin Oncol. 1991, 21:293-8.
  8. Barghouthi N, Perini J, Cheng J: Ectopic adrenocorticotropic hormone production: a case of neuroendocrine cervical small cell carcinoma presenting as Cushing syndrome. AACE Clin Case Rep. 2018, 4:e367-e369. 10.4158/ACCR-2018-0080
  9. Di Filippo L, Vitali G, Taccagni G, Pedica F, Guaschino G, Bosi E, Martinenghi S: Cervix neuroendocrine carcinoma presenting with severe hypokalemia and Cushing’s syndrome. Endocrine. 2020, 67:318-20. 10.1007/s12020-020-02202-x
  10. Ilias I, Torpy DJ, Pacak K, Mullen N, Wesley RA, Nieman LK: Cushing’s syndrome due to ectopic corticotropin secretion: twenty years’ experience at the National Institutes of Health. J Clin Endocrinol Metab. 2005, 90:4955-62. 10.1210/jc.2004-2527
  11. Biller BM, Grossman AB, Stewart PM, et al.: Treatment of adrenocorticotropin-dependent Cushing’s syndrome: a consensus statement. J Clin Endocrinol Metab. 2008, 93:2454-62. 10.1210/jc.2007-2734
  12. Fleseriu M, Biller BM, Findling JW, Molitch ME, Schteingart DE, Gross 😄 Mifepristone, a glucocorticoid receptor antagonist, produces clinical and metabolic benefits in patients with Cushing’s syndrome. J Clin Endocrinol Metab. 2012, 97:2039-49. 10.1210/jc.2011-3350
  13. Young J, Bertherat J, Vantyghem MC, Chabre O, Senoussi S, Chadarevian R, Castinetti F: Hepatic safety of ketoconazole in Cushing’s syndrome: results of a Compassionate Use Programme in France. Eur J Endocrinol. 2018, 178:447-58. 10.1530/EJE-17-0886
  14. Sarlis NJ, Chanock SJ, Nieman LK: Cortisolemic indices predict severe infections in Cushing syndrome due to ectopic production of adrenocorticotropin. J Clin Endocrinol Metab. 2000, 85:42-47. 10.1210/jcem.85.1.6294

 

From https://www.cureus.com/articles/111698-recurrent-neuroendocrine-tumor-of-the-cervix-presenting-with-ectopic-cushings-syndrome

​

Filed under: Cancer, Cushing's, Rare Diseases, symptoms, Treatments | Tagged: , , , | Leave a comment »

TP53 Mutations in Functional Corticotroph Tumors Are Linked to Invasion and Worse Clinical Outcome

Posted on September 28, 2022 by MaryO

Abstract

Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease.

Introduction

Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7].

Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [19, 20].

TP53 is the most commonly mutated gene in malignant neoplasms [21, 22], including brain and neuroendocrine tumors [23, 24]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [8, 16, 25,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [17, 19].

To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features.

Methods

Patients and samples

We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9, 12, 13, 17]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months).

Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation.

The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5].

DNA extraction, TP53 amplification and sequencing

Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [9, 12]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [9, 12]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system.

Statistical analysis

Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant.

Results

Analysis of TP53 nucleotide variants

We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison.

We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing.

Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33].

Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors

Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9).

The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3).

Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup.

Clinical presentation of patients with TP53 mutant tumors

Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4).

Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months).

We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2).

The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127).

Fig. 1

figure 1

Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis

Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B).

No statistical association was found between clinical data and any of the 8 common variants.

Characteristics of TP53 mutant corticotroph tumors

All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018).

Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4).

Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type).

We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells.

Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4).

Discussion

Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [8, 18, 19].

Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [9, 11, 13, 18, 36]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [17, 19].

Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course.

Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [29, 38]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19].

A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation.

In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [19, 20]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development.

A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43].

In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [44, 45]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely.

Conclusion

Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome.

Availability of data and materials

The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request.

Abbreviations

CD:
Cushing’s disease
BADX:
Bilateral adrenalectomy
CTP-BADX/NS:
Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome
ACTH:
Adrenocorticotropic hormone
SD:
Standard deviation
IQR:
Interquartile range
HR:
Hazard ratio

References

  1. Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86

    PubMed PubMed Central Article Google Scholar

  2. McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276

    CAS PubMed Article Google Scholar

  3. Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875

    PubMed Article Google Scholar

  4. Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292

    PubMed Article CAS Google Scholar

  5. Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16

    CAS PubMed PubMed Central Article Google Scholar

  6. Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537

    Article Google Scholar

  7. Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75

    CAS PubMed Article Google Scholar

  8. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38

    CAS PubMed Article Google Scholar

  9. Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004

    PubMed PubMed Central Article Google Scholar

  10. Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317

    CAS PubMed PubMed Central Article Google Scholar

  11. Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226

    CAS PubMed Article Google Scholar

  12. Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65

    Article Google Scholar

  13. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458

    CAS Article Google Scholar

  14. Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851

    CAS PubMed Article Google Scholar

  15. Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259

    CAS PubMed PubMed Central Article Google Scholar

  16. Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171

    PubMed PubMed Central Article CAS Google Scholar

  17. Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283

    CAS PubMed PubMed Central Article Google Scholar

  18. Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5

    CAS PubMed Article Google Scholar

  19. Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842

    PubMed Article Google Scholar

  20. Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194

    PubMed Article Google Scholar

  21. Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93

    Article CAS Google Scholar

  22. Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876

    CAS PubMed Article Google Scholar

  23. Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508

    CAS PubMed PubMed Central Article Google Scholar

  24. van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612

    PubMed PubMed Central Article CAS Google Scholar

  25. Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55

    CAS PubMed Google Scholar

  26. Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814

    CAS Article Google Scholar

  27. Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222

    CAS PubMed Article Google Scholar

  28. Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657

    Article Google Scholar

  29. Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135

    PubMed Article Google Scholar

  30. Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/

  31. Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443

    CAS PubMed PubMed Central Article Google Scholar

  32. Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947

    CAS PubMed Article Google Scholar

  33. Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429

    CAS PubMed PubMed Central Article Google Scholar

  34. Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981

    CAS PubMed Article Google Scholar

  35. Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097

    CAS PubMed Google Scholar

  36. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129

    CAS PubMed Article Google Scholar

  37. Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24

    CAS PubMed Article Google Scholar

  38. Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70

    CAS PubMed Article Google Scholar

  39. Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272

    CAS PubMed Article Google Scholar

  40. Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16

    Google Scholar

  41. Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404

    PubMed Article Google Scholar

  42. Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87

    CAS PubMed Article Google Scholar

  43. Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8

    Article Google Scholar

  44. Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157

    CAS PubMed Article Google Scholar

  45. Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492

    CAS PubMed PubMed Central Article Google Scholar

  46. Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416

    CAS PubMed PubMed Central Article Google Scholar

  47. Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365

    CAS PubMed Article Google Scholar

  48. Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243

    CAS PubMed PubMed Central Article Google Scholar

  49. Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90

    CAS PubMed PubMed Central Article Google Scholar

  50. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861

    CAS PubMed PubMed Central Article Google Scholar

Download references

Funding

Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG).

Author information

Authors and Affiliations

  1. Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyLuis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou
  2. Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, GermanySigrun Roeber & Jochen Herms
  3. Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, FranceGuillaume Assié
  4. Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, FranceGuillaume Assié
  5. Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, GermanyTimo Deutschbein & Martin Fassnacht
  6. Medicover Oldenburg MVZ, Oldenburg, GermanyTimo Deutschbein
  7. Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, BrazilMonica R. Gadelha
  8. Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The NetherlandsAd R. Hermus
  9. Medicover Neuroendocrinology, Munich, GermanyGünter K. Stalla
  10. Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, LuxembourgMaria A. Tichomirowa
  11. Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, GermanyRoman Rotermund & Jörg Flitsch
  12. Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, GermanyMichael Buchfelder
  13. Department of Neurosurgery, University of Tübingen, Tübingen, GermanyIsabella Nasi-Kordhishti & Jürgen Honegger
  14. Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyJun Thorsteinsdottir
  15. Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, GermanyWolfgang Saeger

Contributions

LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft.

Corresponding authors

Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou.

Ethics declarations

Ethics approval and consent to participate

The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome

Skip to file navigationSkip to generic navigation
1
Supplementary Table 1
. Description of study cohort.
Variable
mean/median
SD/IQR
Total n
Age at diagnosis (years), mean ±SD, [total n]
42
±15.2
86
Sex (female), n (%), [total n]
62
(72%)
86
BMI (kg/m2), mean ±SD, [total n]
28.9
±6.3
74
Disease presentation, n (%), [total n]
86
Cushing
66
(77%)
Nelson
20
(23%)
Number of prior pituitary surgeries, n (%), [total n]
80
0
50
(63%)
1
23
(29%)
≥2
7
(9%)
Total
number of pituitary surgeries, n (%), [total n]
82
1
46
(56%)
2
23
(28%)
≥3
13
(16%)
Complete tumor resection, n (%), [total n]
32
(60%)
53
Postoperative remission, n (%), [total n]
46
(59%)
78
Postoperative tumor control, n (%), [total
n]
34
(60%)
57
Radiation therapy, n (%), [total n]
24
(34%)
70
Radiation therapy before sample collection, n (%), [total n]
7
(13%)
53
Bilateral adrenalectomy, n (%), [total n]
23
(27%)
86
Pharmacological treatments
a
,
n (%), [total n]
18
(42%)
43
Preoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
98
(570.4)
75
Serum cortisol (
μ
g/dl), median (range)
29.1
(168.6)
50
24h
–
urinary free cortisol (
μ
g/24h), median (range)
432.5
(598.3)
30
Serum cortisol after low
–
dose DST (
μ
g/dl),
median (IQR)
20
(20.7)
46
Postoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
20
(107.6)
57
Serum cortisol nadir (
μ
g/dl), median (range)
8.8
(19.4)
58
Tumo
r size (mm), median (IQR), [total n]
15
(13.0)
85
Microadenoma
19
(22%)
Macroadenoma
66
(78%)
Granulation, n (%), [total n]
30
Sparsely
9
(30%)
Densely
21
(70%)
Ki67 index, median (IQR), [total n]
2.0
(3.8)
36
Ki67 index ≥3%, n (%)
14
(39%)
36
p53 positivity, median (IQR), [total n]
1
(26.5)
9
Invasion, n (%),
[total n]
34
(53%)
64
Hardy grade, n (%), [total n]
61
1
13
(21%)
2
22
(36%)
3
18
(30%)
4
8
(13%)
Knosp grade, n (%), [total n]
35
0
5
(14%)
1
12
(34%)
2
3
(9%)
3
7
(20%)
4
8
(7%)
Disease
–
specific death, n (%), [total
n]
5
(9%)
58
a
Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide
(n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1
pharmacological agent.
2
Supplementary Table 2
. Primers used for
TP53
amplification and Sanger sequencing.
Primer
Sequence
DNA source
TP53
–
1
5′
–
TCTCATGCTGGATCCCCACT
–
3′
FF, FFPE
TP53
–
1rv
5′
–
GACCAGGTCCTCAGCC
–
3′
FFPE
TP53
–
2fw
5′
–
GGGGGCTGAGGACCTGGT
–
3′
FFPE
TP53
–
2rv
5′
–
ATACGGCCAGGCATTGAAGT
–
3′
FFPE
TP53
–
2
5′
–
AGAGGAATCCCAAAGTTCCA
–
3′
FF
TP53
–
3
5′
–
GTGCCCTGACTTTCAACTC
–
3′
FF, FFPE
TP53
–
3rv
5′
–
GGCAACCAGCCCTGTC
–
3′
FFPE
TP53
–
4fw
5′
–
GCCTCTGATTCCTCACTGAT
–
3′
FFPE
TP53
–
4
5′
–
CAGGAGAAAGCCCCCCTACT
–
3′
FF, FFPE
TP53
–
5
5′
–
CTTGCCACAGGTCTCCCCAA
–
3′
FF, FFPE
TP53
–
6
5′
–
AGGGGTCAGAGGCAAGCAGA
–
3′
FF, FFPE
TP53
–
7
5′
–
TAGGACCTGATTTCCTTA
–
3′
FF, FFPE
TP53
–
7rv
5′
–
AGTGAATCTGAGGCATAAC
–
3′
FFPE
TP53
–
7Bfw
5′
–
TGGAGGAGACCAAGGGTG
–
3′
FFPE
TP53
–
7Brv
5′
–
CGGCATTTTGAGTGTTAGAC
–
3′
FFPE
TP53
–
8
5′
–
TAAGCTATGATGTTCCTTAG
–
3′
FF, FFPE
TP53
–
8rv
5′
–
GACTGTTTTACCTGCAATTG
–
3′
FFPE
TP53
–
9
5′
–
CAATTGTAACTTGAACCATC
–
3′
FF, FFPE
TP53
–
10
5′
–
GGATGAGAATGGAATCCTAT
–
3′
FF, FFPE
TP53
–
11
5′
–
TCTCACTCATGTGATGTCATC
–
3′
FF, FFPE
TP53
–
12
5′
–
CACACCTATTGCAAGCAAGG
–
3′
FF, FFPE
FF, fresh frozen; FFPE, formalin
–
fixed
paraffin embedded.

Additional file 1

. Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS.

 

Filed under: Cushing's, pituitary, Rare Diseases | Tagged: , , , | Leave a comment »

Next Page »
%d bloggers like this: