A Case of Recurrent Cushing’s Disease With Optimised Perinatal Outcomes

Abstract

Summary

This is a case of a patient with a 10-year history of Cushing’s disease (CD) that was previously treated with transsphenoidal pituitary tumour resection. Conception occurred spontaneously, and during early pregnancy recurrent CD became apparent both clinically and biochemically. Repeat transsphenoidal surgery took place during the second trimester, and the high-risk pregnancy resulted in a live neonate. Despite evidence of hypercortisolism and recurrent CD at 6 months postpartum, the patient had a second successful, uncomplicated pregnancy, further adding to the rarity and complexity of this case. Pregnancy in CD is rare because hypercortisolism seen in CD suppresses gonadotropin release, leading to menstrual irregularities and infertility. Diagnosis of CD is particularly challenging because many clinical and biochemical features of normal pregnancy overlap considerably with those seen in CD. Diagnosis and treatment are extremely important to reduce rates of perinatal morbidity and mortality.

Learning points

  • Hypercortisolism suppresses gonadotropin release, leading to menstrual irregularities and infertility. In CD, hypersecretion of both androgens and cortisol further contributes to higher rates of amenorrhoea and infertility.
  • Pregnancy itself is a state of hypercortisolism, with very few studies detailing normal ranges of cortisol in each trimester of pregnancy for midnight salivary cortisol and urinary free cortisol testing.
  • Treatment of CD reduces maternal morbidity and rates of foetal loss, and can be either surgical (preferred) or medical.
  • CD can relapse, often many years after initial surgery.
  • There are a limited number of cases of Cushing’s syndrome in pregnancy, therefore, the best possible treatment is difficult to determine and should be individualised to the patient.

Background

CD is rare in the general population. It is even rarer to present as a clinical conundrum during pregnancy. Diagnosis is challenging due to the overlap of physiological hormonal changes during pregnancy with features of Cushing’s syndrome, and it is further complicated by limited data for cortisol reference ranges in a pregnant state. The prognostic benefits of treatment of CD in pregnancy in reducing perinatal morbidity and mortality must be carefully weighed up against the risks of surgery and/or medical management in pregnancy.

Case presentation

The patient was a 31-year-old female diagnosed with Cushing’s disease at age 20 years. Initial clinical features were oligomenorrhoea, weight gain, hypertension, and impaired glucose tolerance. She had markedly elevated 24 h urinary free cortisol (UFC) of 1,984 nmol/day, which was six times the upper limit of normal (ULN). Results of a 1 mg dexamethasone suppression test (DST) showed failure to suppress cortisol levels, with an elevated morning cortisol of 695 nmol/L (reference range (RR): 100–690). ACTH levels remained inappropriately normal at 7.3 pmol/L (RR: < 12.1), suggesting ACTH-dependent hypercortisolism. A 5 mm by 4.4 mm microadenoma was identified on magnetic resonance imaging (MRI) scan of the pituitary gland, and she underwent initial transsphenoidal pituitary adenectomy. Histopathological examination demonstrated positive staining for adrenocorticotrophic hormone (ACTH). Immediately after surgery, she required hydrocortisone and levothyroxine replacement for several months, which was gradually weaned and eventually ceased. She had routine MRI with gadolinium and biochemical surveillance for 5 years, which showed cortisol levels within the normal ranges and no visible pituitary lesion on imaging, and she was then lost to follow-up. Results of 1 mg DST and 24 h UFC measurements were not available from this time period. Other medical history was significant for mild depression. The patient was a non-smoker and did not drink alcohol.

At age 30 years, the patient experienced weight gain and facial rounding, prompting an endocrinology referral. While awaiting review, she spontaneously achieved conception and was confirmed to be 6 weeks’ gestation at time of the first visit. An early diagnosis of gestational diabetes mellitus was made, and she commenced insulin therapy. Gestational hypertension was also confirmed, treated with methyldopa 500 mg mane and 250 mg midi. Other medications included folic acid 5 mg daily, cholecalciferol, and ferrous sulphate.

The patient was referred to a tertiary hospital high-risk pregnancy service for ongoing care. She was initially reviewed at 8 + 5 weeks’ gestation and was noted to have plethora, round facies, and prominent dorsocervical fat pads. Central adiposity with violaceous striae over the lower abdomen was evident. Visual fields were normal to gross confrontation, and formal visual field assessment was confirmed to be normal. Weight was 70 kg, with BMI 26.7 kg/m2.

As pregnancy progressed, insulin and antihypertensive requirements increased, with an additional methyldopa 250 mg nocte required to keep blood pressure at target.

Investigation

The 24 h UFC was 450 nmol/24 h (1.5× ULN of non-pregnant reference range). Late-night salivary cortisol (LNSC) was 17 nmol/L (non-pregnant reference range <8 nmol/L). Serum pathology results are shown in Table 1. MRI brain performed at 6 weeks’ gestation revealed a possible 6 by 4 mm nodule in the left lateral aspect of the sella (Fig. 1). IV contrast was not used as the patient was within the first trimester.

Table 1Laboratory investigations at initial consultation (8 + 5 weeks gestation). Bold values indicate abnormal results.

Investigation Result Reference range
Fasting glucose, mmol/L 5.2
HbA1c, % 5.4
24 h urinary cortisol, nmol/d 450 54–319
Cortisol (08:22), nmol/L 521 138–650
Midnight salivary cortisol, nmol/L 17 <8
ACTH, pmol/L 10 <12.1
IGF-1, nmol/L 31 12–42
Growth hormone, mIU/L 2.9 0–15
TSH, mIU/L 2.34 0.4–3.2
FT4, pmol/L 11.9 11–17
Figure 1
Figure 1
MRI brain without IV contrast performed in the first trimester of the patient’s first pregnancy, demonstrating a T2 hypointense lesion in the left lateral aspect of the sella, which is most likely consistent with a pituitary adenoma.

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2025, 4; 10.1530/EDM-25-0092

At 14 weeks’ gestation, the repeat 24 h UFC was 542 nmol/L and LNSC was 17 nmol. There is a lack of pregnancy-specific reference ranges for 24 h UFC or LNSC measurements, making it difficult to make a definitive biochemical diagnosis. After careful discussion in a multidisciplinary team meeting, she proceeded with bilateral inferior petrosal sinus sampling (IPSS), which demonstrated a central to peripheral gradient with values presented in Table 2.

Table 2Results of bilateral inferior petrosal sinus sampling. ACTH (ng/L) at different timepoints are presented.

0 2 min 5 min 10 min 15 min
Right 258 823 1,040 864 728
Left 73 196 228 263 234
Peripheral 12 41 56 81 86
Right: peripheral 21.50 20.07 18.57 10.67 8.46
Left: peripheral 6.08 4.78 4.07 3.25 2.72

Treatment

The patient underwent transsphenoidal resection of her adenoma at 17+ weeks’ gestation. She recovered uneventfully.

Day 1 postoperative cortisol level remained elevated at 706 nmol/L, falling to 587 nmol/L by Day 3. Postoperative steroid treatment was not required.

Histopathological examination demonstrated a pituitary adenoma with mild nuclear atypia and infrequent positive ACTH staining (Fig. 2). In addition to the tumour and normal pituitary tissue, there was also abundant eosinophilic proteinaceous material present, which may have suggested contents of an associated cyst, although presence of cyst lining was not present to confirm this diagnosis. A small fragment of included bone appeared invaded by the adenoma within the resected tissue.

Figure 2
Figure 2
Positive ACTH staining in pituitary adenoma.

Citation: Endocrinology, Diabetes & Metabolism Case Reports 2025, 4; 10.1530/EDM-25-0092

Outcome and follow-up

The patient’s insulin and antihypertensive requirements plateaued postoperatively. Serial ultrasound showed that the fetal size was consistently in the 15th percentile. There were no features of preeclampsia throughout gestation.

At 35 + 5 weeks’ gestation, she had premature rupture of membranes and delivered a healthy live male infant weighing 2,250 g via normal vaginal delivery. Diabetes and hypertension resolved promptly after delivery, with cessation of insulin and antihypertensive medications.

At 5 weeks postpartum morning cortisol was within normal range at 265 nmol/L, with ACTH 6.8 pmol/L. At 10 weeks postpartum, the 24 h UFC was within normal limits at 136 nmol/day, and a 1 mg DST showed a detectable, equivocal cortisol level of 98 nmol/L. Repeat MRI pituitary was performed 2 months postpartum, which did not show any residual pituitary adenoma. No pituitary hormone replacement was required.

By 6 months postpartum, repeat 1 mg DST showed failure to suppress cortisol, with cortisol level at 154 nmol/L (RR without dexamethasone: 138–650 nmol/L), suggesting residual CD. Ambulatory blood pressure monitoring revealed essential hypertension, with average BP 141/101 mmHg across 24 h, requiring treatment with methyldopa. Despite evidence of residual CD, the patient desired a second pregnancy. Reassuringly, her cortisol burden was low, with LNSC 5 nmol/L (RR: < 8) and 24 h UFC 143 nmol/day (non-pregnant RR: 54–319), both within reference range. No definite lesion was identified on MRI brain with intravenous contrast. Extensive discussions between the endocrinologist, maternal–foetal medicine specialist, neurosurgeon, and the patient were held. The pros and cons of pursuing further treatment such as radiotherapy versus proceeding with pregnancy despite suggestion of active Cushing’s disease were explicitly discussed.

The patient confirmed her second pregnancy 11 months after the birth of her first child, and this proceeded without complications. There was no evidence of gestational diabetes on 75 g glucose tolerance tests performed at 16 and 26 weeks’ gestation. Blood pressure was well managed on methyldopa alone. She delivered a healthy male infant via normal vaginal delivery at 38 weeks’ gestation and breastfed successfully. MRI was performed at 16 weeks postpartum and did not show an appreciable sella/suprasellar mass. Repeat 24 h UFC was 275 nmol/day, consistent with ongoing CD. Clinical features of CD returned, included central adiposity, liver function test derangement, and raised HbA1c with fasting hyperinsulinaemia. Pituitary radiation therapy was discussed, including the possibility of more than one dose being required, the strong likelihood of inducing panhypopituitarism, and the unknown duration of time between radiation and remission (1). The alternative option of medical management with osilodrostat was discussed, given its recent availability and government subsidy in Australia. The patient was recently commenced on osilodrostat 1 mg twice daily after ECG attendance to exclude prolonged QTc, and patient education regarding the potential risk of hypoadrenalism and when to seek medical attention.

Discussion

Managing Cushing’s disease (CD) in pregnancy is complex and requires a multidisciplinary approach, as recurrence can occur years after initial remission. Suspected Cushing’s syndrome (CS) requires careful assessment. In cases where active disease poses significant maternal and foetal risks, transsphenoidal pituitary surgery can be safely performed in the second trimester. CD increases the risk of gestational diabetes and hypertension, requiring close monitoring to optimise outcomes. Postpartum, persistent hypercortisolism may indicate recurrence, highlighting the need for long-term endocrine follow-up. Despite mild residual disease, successful pregnancies are possible with appropriate monitoring and management, emphasising the importance of thorough family planning discussions.

UFC values are twice as high in pregnant patients compared to non-pregnant controls (2). In the first trimester of normal pregnancy, UFC values are normal, but by the third trimester, they increase three-fold up to values seen in CS (3). Therefore, CS should only be suspected when UFC values in the second and third trimesters are greater than three times the upper limit of normal (3). LNSC is a useful screening test because in CS, the usual circadian nadir of cortisol secretion is lost. At least 2–3 UFC and/or NSC screening tests are recommended (4). Lopes et al. (5) established reference values for LNSC with suggested normal ranges of 0.8–6.9 nmol/L in the first trimester, 1.1–7.2 nmol/L in the second trimester, and 1.9–9.1 nmol/L in the third trimester (5). The use of a 1 mg DST in pregnancy is not recommended because the hypothalamus–pituitary–adrenal (HPA) axis response to exogenous glucocorticoids is blunted, making it difficult to interpret test results (3).

Adrenal adenomas are responsible for 40–50% of CS cases in pregnancy, while CD causes 33% (3). In non-pregnant patients, ACTH levels are useful to classify the likely cause of CS. Undetectable ACTH levels cannot be relied upon for diagnosis in pregnancy because ACTH levels are elevated in pregnancy (3). Using high-dose dexamethasone suppression testing (HDST) as an initial test in pregnant patients has been recommended (3). A lack of suppression of ACTH with administration of high-dose dexamethasone suggests adrenal aetiology. However, HDST is not always definitive (3). Ultrasound imaging of the adrenal glands is also recommended as an initial investigation because most adrenal lesions can be visualised (35). Pregnancy complicates visualisation of a pituitary mass by MRI imaging because physiologic enlargement of the pituitary gland during pregnancy may mask small tumours (6). Non-contrast MRI has reduced sensitivity for detection of CD. However, gadolinium contrast is not recommended in pregnant women (7).

Inferior petrosal sinus sampling (IPSS) is the gold standard for diagnosing CD in the non-pregnant population (4). The most recent guidelines for diagnosis of CS suggest that IPSS is not necessary for diagnosis if MRI clearly shows a tumour >10 mm in the context of dynamic test results and clinical features that also strongly suggest CD (4). Lindsay and colleagues (3) caution the use of IPSS unless prior non-invasive testing remains equivocal due to risks of thromboembolism and exposure to radiation posed by IPSS (3). However, these risks can be mitigated with extra precautions during pregnancy, including use of lead barrier protection, a direct jugular approach, and with the procedure occurring at a specialised centre (3).

Treatment of CS in pregnancy should be individualised depending on the patient presentation and gestational age (4). Active treatment of CS, by either medical or surgical intervention, reduces maternal morbidity and rates of foetal loss (4). Surgery is usually preferred because there are fewer complications at delivery and it has high rates of remission (8). Surgery reduces rates of perinatal and maternal morbidity but does not reduce rates of preterm birth and intrauterine growth restriction (IUGR) (9). Pituitary or adrenal surgery should ideally be done in the second trimester, before week 24 of pregnancy, in a high-volume centre with multidisciplinary team input (8). There is a risk of spontaneous abortion with anaesthesia given in the first trimester and an increased risk of premature labour with anaesthesia given in the third trimester (7).

Unfortunately, CD can recur, and 50% of recurrence occurs within 50 months of pituitary surgery (14). Recurrence is defined as ongoing clinical and biochemical evidence of hypercortisolism after an initial period of remission. Factors that increase the likelihood of postoperative remission included the identification of a tumour on MRI pre-surgery, no invasion of the sinus cavernous by the adenoma, older age (greater than 35 years), low postoperative cortisol and ACTH levels, and long-term hypocortisolism (greater than 1 year) (1). A second pituitary surgery is often the first-line treatment option in recurrence, which has overall lower rates of remission compared to first surgery and increased risk of hypopituitarism due to scar tissue in the pituitary and often the need for more aggressive surgical technique (1). Both fractionated radiotherapy and stereotactic radiosurgery are therapeutic options and achieve high rates of remission (1).

There are no medications that are approved for treatment of CD in pregnancy, although the latest guidelines suggest consideration of metyrapone, ketoconazole, or cabergoline (46). The newer agent, osilodrostat inhibits the enzymes 11-beta-hydroxylase and 18-hydroxylase, reducing production of cortisol and aldosterone respectively, thereby normalising UFC values, reducing systolic and diastolic blood pressure, fasting blood glucose levels, and improving body weight in clinical trials (10). There is no information on osilodrostat use and safety in pregnancy, but it is an effective agent in patients who are unsuitable for surgery and patients with recurrent disease after surgery (10). It is associated with risk of hypoadrenalism, prolongation of the QTc interval, and increased serum testosterone levels, particularly at higher doses (10). Each medication poses its own risk of side effects and therefore treatment must be individualised. Overall, medical treatment should only be used in pregnancy when surgical treatment is contraindicated (6).

Our case demonstrates a rare case of CD in pregnancy with no significant adverse perinatal outcomes for mother or baby, albeit late preterm delivery in the first pregnancy. Ongoing endocrinology surveillance is essential to monitor for recurrent CD.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

This research did not receive any specific grant from any funding agency in the public, commercial, or not-for-profit sector.

Patient consent

Written informed consent for publication of their clinical details was obtained from the patient.

Author contribution statement

Several case details and timeline of events were gathered by EW. This is a patient of SG.

References

Reconstructive Liposuction for Residual Lipodystrophy After Remission of Cushing’s Disease

Abstract

Cushing’s syndrome (CS) is often presented due to an adrenocorticotropic hormone (ACTH)-secreting pituitary adenoma, characterized by high chronic cortisol levels. Surgical resection of the pituitary adenoma is the primary treatment, but long-term metabolic and physical sequelae can persist, affecting psychological well-being and social functioning. Glucocorticoids are directly involved in alterations of fat metabolism, favoring centripetal adiposity. Even after hormonal normalization, patients may experience residual lipodystrophy. Impairment of body image may cause psychological distress and social isolation. The objective is to illustrate the potential therapeutic value of reconstructive liposuction in restoring body image and psychological well-being in a patient with persistent lipodystrophy after Cushing’s disease remission.

We report a case of a 16-year-old female with recurrent Cushing’s disease secondary to a pituitary microadenoma, confirmed by elevated urinary free cortisol and magnetic resonance imaging (MRI). It was initially treated with transsphenoidal resection in 2019; disease recurrence was confirmed and again treated in 2024. Despite intervention, the prolonged hypercortisolism developed into secondary lipodystrophy, leading to severe body image dissatisfaction and social withdrawal. Thyroid function remained euthyroid, ruling out metabolic contributors. Because of the psychological distress caused by persistent fat redistribution, the patient underwent elective liposuction in 2025. Postoperative follow-up revealed reduced psychological distress and improved well-being and self-esteem. Reconstructive liposuction can play a key role in the treatment and management of persistent post-CS lipodystrophy, contributing significantly to psychological recovery. Prospective studies evaluating surgical criteria and long-term psychosocial outcomes are needed to define eligibility criteria and assess outcomes, leading to the development of clinical guidelines for aesthetic interventions in post-CS recovery.

Introduction

Corticotroph pituitary adenomas (corticotropinomas) are pituitary tumors that secrete excess adrenocorticotropic hormone (ACTH), causing endogenous Cushing’s syndrome (CS). Most of these adenomas are sporadic and monoclonal, although in some rare cases, they are associated with germline mutations (e.g., in USP8) or genetic syndromes [1,2]. Clinically, excess ACTH causes a classic presentation with centripetal obesity, purple striae, muscle asthenia, hypertension, and emotional disturbances such as depression or anxiety [3-5]. Chronically elevated cortisol levels promote fat deposition in central body regions – face, neck, torso, and abdomen – at the expense of relative thinning of the limbs [3], leading to lipodystrophy that can seriously affect the patient’s quality of life.

At the molecular level, glucocorticoids stimulate the differentiation of preadipocytes into mature adipocytes and enhance lipoprotein lipase activity in peripheral fat tissues [6], thereby increasing the uptake of circulating fatty acids and the storage of triglycerides. At the same time, they increase hepatic lipogenesis and modulate cortisol receptor homeostasis (e.g., 11β-HSD1 in adipose tissue), favoring visceral fat distribution [6]. Although glucocorticoids can induce acute lipolysis, they exert chronic lipogenic effects – especially in subcutaneous adipose tissue – which promotes fat accumulation in the face, neck, and trunk [6]. This central adiposity, characteristic of CS, is further enhanced by increased hepatic lipogenesis and the overexpression of 11β-HSD1 in adipose tissue, which amplifies the local action of cortisol [6].

Case Presentation

In 2019, a 16-year-old female patient was initially diagnosed with a 4 × 3 mm pituitary microadenoma (Figure 1), following clinical suspicion of Cushing’s disease. The diagnosis was confirmed through imaging studies and endocrinological testing, which revealed consistently elevated urinary free cortisol levels ranging from 459 to 740.07 µg/24 hours (normal range: <50 µg/24 hours), indicative of endogenous hypercortisolism. No dynamic load tests (such as dexamethasone suppression or ACTH stimulation) were performed, as the diagnosis was supported by the clinical context and laboratory findings. Moreover, no clinical or biochemical evidence of adrenal insufficiency was observed during follow-up.

T1-weighted-sagittal-MRI-scan-showing-a-corticotroph-pituitary-microadenoma-(4-×-3-mm)-circled-in-red
Figure 1: T1-weighted sagittal MRI scan showing a corticotroph pituitary microadenoma (4 × 3 mm) circled in red

The lesion is localized within the anterior pituitary gland, consistent with an ACTH-secreting adenoma causing Cushing’s disease in the patient.

MRI, magnetic resonance imaging; ACTH, adrenocorticotropic hormone

The patient underwent transsphenoidal endonasal resection of the pituitary tumor in 2019. Although initially successful, disease recurrence was confirmed, and a second endonasal transsphenoidal surgery was performed in 2024. Despite these interventions, the prolonged hypercortisolism led to the development of secondary lipodystrophy, manifesting as centripetal fat accumulation, a dorsal fat pad, and disproportionate truncal adiposity (Figure 2). These physical alterations had a significant psychosocial impact, as reported by the patient during follow-up visits, resulting in body image dissatisfaction, low self-esteem, and social withdrawal. No formal psychometric scales were administered.

Preoperative-and-intraoperative-images-of-the-patient
Figure 2: Preoperative and intraoperative images of the patient

A and B panels show the anterior and posterior views prior to liposuction, demonstrating centripetal adipose accumulation characteristic of Cushing’s syndrome. The C panel shows the intraoperative stage following abdominal and flank liposuction, with placement of drainage tubes, and visible reduction in subcutaneous fat volume.

A thyroid function panel revealed a slightly elevated thyroid-stimulating hormone (TSH) level (4.280 μUI/mL; reference range: 0.270-4.200), with total and free T3 and T4 values within normal limits, ruling out clinically significant hypothyroidism as a confounding factor for her phenotype. The biochemical profile suggested a euthyroid state, despite borderline TSH elevation, which was interpreted as a subclinical or adaptive response to chronic cortisol excess (Table 1).

Parameter Normal Range Patient’s Value
Cortisol (µg/24 hour) 58.0 – 403.0 459.5 – 740.07
TSH (µUI/mL) 0.270 – 4.200 4.280
Total T3 (ng/mL) 0.80 – 2.00 1.02
Free T3 (pg/mL) 2.00 – 4.40 3.33
Total T4 (µg/dL) 4.50 – 12.00 8.63
Free T4 (ng/dL) 0.92 – 1.68 1.36
Table 1: Comparison between the patient’s hormone levels and standard reference ranges

A persistently elevated 24-hour urinary cortisol range is observed, consistent with endogenous hypercortisolism. The thyroid profile remains within normal limits, with a mildly elevated TSH in the absence of overt thyroid dysfunction. These findings support the functional and metabolic profile characteristic of Cushing’s syndrome.

TSH, thyroid-stimulating hormone

The procedure targeted lipodystrophic regions identified through clinical examination and patient concerns, rather than formal imaging or anthropometric measurements. It aimed to restore body contour, alleviate somatic distress, and improve her overall self-perception and quality of life. Postoperative follow-up revealed patient-reported improvements in body image and psychological well-being. While these outcomes were not evaluated with formal instruments, the clinical improvement was evident and significant from the patient’s perspective, highlighting the role of plastic surgery not only as a reconstructive tool, but also as a therapeutic strategy for restoring dignity and social functioning in patients recovering from CS.

Discussion

After successful treatment of the pituitary adenoma, many metabolic parameters improve; however, fat distribution usually only partially reverses. Longitudinal studies show that, in the medium term, weight and abdominal circumference decrease, and there is some redistribution of fat toward the limbs following cortisol remission [3].

For example, Bavaresco et al. (2024) observed that, after hormone levels normalized, total fat was reduced and part of it shifted from the visceral area to the legs [3]. Nevertheless, their review highlights that a significant proportion of patients continue to present with residual visceral adiposity and moderate obesity (body mass index, or BMI >25), despite hormonal control [7]. In our case, truncal adiposity persisted based on clinical assessment, though no formal anthropometric measurements were performed.

Although liposuction is not traditionally considered first-line therapy for cortisol-induced lipodystrophy secondary to Cushing’s disease, increasing evidence from related lipodystrophic syndromes supports its clinical utility. For instance, in human immunodeficiency virus (HIV)-associated cervicodorsal lipodystrophy, Barton et al. (2021) conducted a 15-year retrospective analysis comparing liposuction and excisional lipectomy, finding that 80% of patients undergoing liposuction alone experienced recurrence, while none of the patients treated with excisional lipectomy showed recurrence – albeit with a higher risk of postoperative seroma formation [7]. These findings underscore that, while liposuction may be less durable than excision, it remains a viable option for selected cases, especially when used for contouring or as an adjunct [7]. Similarly, the Endocrine Society guidelines on lipodystrophy management emphasize the importance of personalized approaches, particularly when localized adipose accumulation contributes to persistent metabolic dysfunction or psychological distress [8]. Akinci et al. (2024) also highlight that, even in partial or atypical lipodystrophy syndromes, patients often report substantial impairment in quality of life due to disfiguring fat redistribution [9]. In this context, liposuction should not be dismissed as merely cosmetic but considered part of a functional and psychosocial rehabilitation strategy. The present case exemplifies this rationale, as the patient – despite biochemical remission of Cushing’s disease – continued to experience debilitating body image disturbances and emotional distress, which were ameliorated following targeted liposuction. This supports the integration of body-contouring procedures into multidisciplinary care protocols for endocrine-related lipodystrophies, especially when residual physical stigma persists after hormonal normalization [7-9].

Body image disorders, such as those secondary to CS or lipodystrophy, significantly impact self-perception, self-esteem, and social functioning. For example, a study by Alcalar et al. (2013) reported that patients with active Cushing’s disease had significantly lower SF-36 scores – particularly in emotional role functioning and mental health domains – compared to controls [10]. Similarly, Akinci et al. (2024) described that patients with partial lipodystrophy demonstrated marked reductions in EQ-5D index values and visual analog scale (VAS) scores, indicating impaired health-related quality of life [9]. These findings underscore that fat redistribution disorders can substantially compromise psychosocial well-being, even after endocrine remission.

This is especially relevant in women, where sociocultural stereotypes surrounding female physical appearance reinforce thinness, symmetry, and youthfulness as standards of personal value and social acceptance [1]. This societal context amplifies body dissatisfaction when visible physical changes occur, even after the clinical remission of endocrine diseases, often leading to social withdrawal, anxiety, or depression [3,10]. Within this framework, plastic surgery – such as reconstructive liposuction – has proven to be a valuable therapeutic tool, offering physical restoration that can enhance self-confidence and promote social reintegration [4]. Postoperative follow-up in our case revealed patient-reported improvements in body image and psychological well-being. While these outcomes were not assessed using formal psychometric tools, the clinical benefit was evident from the patient’s perspective. This aligns with prior findings demonstrating the psychosocial value of reconstructive surgery, which can enhance self-esteem and social reintegration after physical disfigurement [11,12]. These observations underscore the role of plastic surgery not only as a reconstructive intervention, but also as a therapeutic strategy for restoring dignity and quality of life in patients recovering from CS.

Although validated psychometric instruments such as the Body Image Quality of Life Inventory (BIQLI) and the Dysmorphic Concern Questionnaire (DCQ) are available to assess body image disturbances, these were not applied in our case. Nonetheless, they represent useful tools for evaluating subjective impact in both clinical practice and research settings. The BIQLI evaluates the effect of body image on various aspects of life – social interactions, self-worth, sexuality, and emotional well-being – using a Likert scale ranging from -3 (very negative impact) to +3 (very positive impact), providing a quantifiable assessment of its influence on quality of life [5]. The DCQ, on the other hand, identifies dysfunctional concerns about perceived physical flaws by assessing behaviors such as avoidance, mirror checking, and concealment; higher scores are associated with suspected body dysmorphic disorder (BDD) [6]. These tools are useful for initial diagnosis, surgical candidate selection, and postoperative follow-up, as they objectively measure subjective changes related to body image. Their advantages include ease of use, clinical validity, and applicability in research settings. However, they also have limitations: they do not replace comprehensive psychological evaluation, may be influenced by cultural context, and do not detect deeper psychiatric comorbidities. Therefore, a multidisciplinary and ethically grounded approach – integrating plastic surgery, endocrinology, and psychology – is essential to ensure safe and patient-centered treatment planning.

Aesthetic liposuction is associated with significant improvements in perceived body image and patient quality of life [11]. For example, Papadopulos et al. (2019) observed statistically significant increases in perception of one’s own body appearance and high satisfaction with postoperative results [12]. These aesthetic gains were accompanied by psychological improvements: the same study documented an increase in emotional stability and a reduction in postoperative anxiety [12]. Similarly, Kamundi (2023) found that nearly all assessed dimensions of quality of life improved after liposuction (p < 0.05 in most of them). Altogether, these findings suggest that liposuction not only corrects physical alterations typical of CS, but also strengthens self-esteem and psychological well-being by substantially improving satisfaction with one’s body image [11].

Moreover, self-esteem influences adherence to medical treatments and lifestyle changes. By improving self-image through reconstructive surgery, it is plausible that the patient feels more motivated to maintain healthy habits, such as diet and regular exercise, that prevent metabolic relapse [12,13].

Nonetheless, it is important to emphasize that liposuction, in this context, should be viewed as a reconstructive complement, not a primary treatment. There are no established protocols or formal guidelines that explicitly include plastic surgery in the care of cured CS; the decision is personalized, based on the residual functional and psychological impact.

Conclusions

Reconstructive plastic surgery, though not a primary therapeutic approach for CS, plays a key role in enhancing patients’ quality of life following remission. Liposuction, in particular, offers a safe and effective solution for persistent lipodystrophy, providing aesthetic benefits with minimal scarring, rapid recovery, and low complication rates in properly selected patients.

This case underscores the importance of addressing both physical and psychosocial sequelae after endocrine stabilization. A multidisciplinary approach – encompassing endocrinology, neurosurgery, and plastic surgery – not only restores physical appearance but also contributes to emotional recovery, self-esteem, and overall patient satisfaction.

References

  1. Tatsi 😄 Cushing syndrome/disease in children and adolescents. Endotext [Internet]. Feingold KR, Ahmed SF, Anawalt B, et al. (ed): MDText.com, Inc., South Dartmouth (MA); 2000.
  2. Mir N, Chin SA, Riddell MC, Beaudry JL: Genomic and non-genomic actions of glucocorticoids on adipose tissue lipid metabolism. Int J Mol Sci. 2021, 22:8503. 10.3390/ijms22168503
  3. Bavaresco A, Mazzeo P, Lazzara M, Barbot M: Adipose tissue in cortisol excess: what Cushing’s syndrome can teach us?. Biochem Pharmacol. 2024, 223:116137. 10.1016/j.bcp.2024.116137
  4. Nieman LK: Molecular derangements and the diagnosis of ACTH-dependent Cushing’s syndrome. Endocr Rev. 2022, 43:852-77. 10.1210/endrev/bnab046
  5. Patni N, Chard C, Araujo-Vilar D, Phillips H, Magee DA, Akinci B: Diagnosis, treatment and management of lipodystrophy: the physician perspective on the patient journey. Orphanet J Rare Dis. 2024, 19:263. 10.1186/s13023-024-03245-3
  6. Peckett AJ, Wright DC, Riddell MC: The effects of glucocorticoids on adipose tissue lipid metabolism. Metabolism. 2011, 60:1500-10. 10.1016/j.metabol.2011.06.012
  7. Barton N, Moore R, Prasad K, Evans G: Excisional lipectomy versus liposuction in HIV-associated lipodystrophy. Arch Plast Surg. 2021, 48:685-90. 10.5999/aps.2020.02285
  8. Brown RJ, Araujo-Vilar D, Cheung PT, et al.: The diagnosis and management of lipodystrophy syndromes: a multi-society practice guideline. J Clin Endocrinol Metab. 2016, 101:4500-11. 10.1210/jc.2016-2466
  9. Akinci B, Celik Gular M, Oral EA: Lipodystrophy syndromes: presentation and treatment. Endotext [Internet]. Feingold KR, Anawalt B, Boyce A, et al. (ed): MDText.com, Inc., South Dartmouth (MA); 2024.
  10. Alcalar N, Ozkan S, Kadioglu P, Celik O, Cagatay P, Kucukyuruk B, Gazioglu N: Evaluation of depression, quality of life and body image in patients with Cushing’s disease. Pituitary. 2013, 16:333-40. 10.1007/s11102-012-0425-5
  11. Kamundi RK: Determining the Impact of Liposuction on Patient Satisfaction of Quality of Life and Body Image: A Prospective Study in Nairobi, Kenya. University of Nairobi, Nairobi; 2023.
  12. Papadopulos NA, Kolassa MJ, Henrich G, Herschbach P, Kovacs L, Machens HG, Klöppel M: Quality of life following aesthetic liposuction: a prospective outcome study. J Plast Reconstr Aesthet Surg. 2019, 72:1363-72. 10.1016/j.bjps.2019.04.008
  13. Saariniemi KM, Salmi AM, Peltoniemi HH, Charpentier P, Kuokkanen HOM: Does liposuction improve body image and symptoms of eating disorders?. Plast Reconstr Surg Glob Open. 2015, 3:461. 10.1097/GOX.0000000000000440

From https://www.cureus.com/articles/376886-reconstructive-liposuction-for-residual-lipodystrophy-after-remission-of-cushings-disease-a-case-report#!/

Older Adults With Cushing’s Disease Present With Fewer Symptoms Than Younger Patients

Key takeaways:

  • Older age was tied to a higher prevalence of 10 comorbidities among a group of 608 people with Cushing’s disease.
  • Younger age was associated with most hallmark features of Cushing’s disease.

The presentation of Cushing’s disease varies by age, with older adults having fewer hallmark features of the condition and more comorbidities, according to study findings published in The Journal of Clinical Endocrinology & Metabolism.

Researchers assessed data from 608 people diagnosed with Cushing’s disease and treated with a transsphenoidal tumor resection at 11 academic pituitary centers in the U.S. from 2003 to 2023 (82% women; 77.3% white). Patients were divided into 10-year age interval groups, with the youngest group consisting of those aged 10 to 19 years and the oldest containing adults aged 70 to 79 years. Researchers found Cushing’s disease presents differently as adults age, with older adults experiencing more comorbidities and complications, but fewer hallmark features such as weight gain, facial rounding and hirsutism.

“The diagnosis of Cushing’s disease remains challenging, particularly with age,” Won Kim, MD, associate clinical professor of neurosurgery and radiation oncology at the David Geffen School of Medicine at UCLA, told Healio. “The older a patient is, the more likely that he or she may have a slower-growing tumor with fewer classic manifestations of the disease.”

Kim and colleagues obtained data from the Registry of Adenomas of the Pituitary and Related Disorders. Hallmark features of Cushing’s disease were identified by consensus opinion.

The number of comorbidities increased with patient age (beta = 0.0466; P < .001), according to the researchers.

Older age was associated with several comorbidities for patients with Cushing’s disease, including hypertension (P < .001), diabetes (P < .001), hyperlipidemia (P < .001), cancer (P < .001), coronary artery disease (P < .001), chronic obstructive pulmonary disease (P = .044), cardiac arrhythmia (P = .023), hepatitis (P = .038), anxiety (P = .039) and osteopenia (P = .024). The most common comorbidity was hypertension, which was prevalent in 67.2% of participants.

In an analysis of presenting hallmark features of Cushing’s disease, younger age was positively associated with weight gain (P < .001), facial rounding (P < .001), abdominal striae (P < .001), hirsutism (P < .001), menstrual irregularities (P < .001) and acne (P < .001). Older age was positively tied to obstructive sleep apnea (P = .007). The most common hallmark feature of Cushing’s disease was weight gain, prevalent in 80.2% of patients.

“Our work highlights that we must lower our threshold for suspecting Cushing’s disease in patients without the classic physical manifestations as the age of the patient increases,” Kim said in an interview. “Subtle clues, such as increasingly difficult to control medical conditions such as hypertension and diabetes, may be the only things we see.”

Older age was associated with lower preoperative 24-hour urinary free cortisol levels (beta = –0.0256; P = 6.89 x 10-7), but higher postoperative nadir cortisol (beta = 0.0342; P = 1.03 x 10-4) and higher adrenocorticotropin (beta = 0.0204; P = 5.22 x 10-4).

In an assessment of tumor characteristics, older age was tied to having a higher Knosp grade tumor (beta = 0.011; P = .00435), greater tumor volume (beta = 0.0261; P = .0233) and higher maximum tumor dimension (beta = 0.009; P = 3.82 x 10-4). Older age was inversely associated with Ki-67 index, which is a measure of tumor’s proliferation (beta = –0.0459; P = 1.39 x 10-4).

Age was not associated with a patient’s number of surgical complications. Older age was linked to a greater prevalence of deep vein thrombosis or venous thromboembolism (beta = 0.07; P = .014). Younger age was tied to a higher prevalence of postoperative arginine vasopressin (beta = –0.02; P = .048).

Kim said the study’s findings should encourage health care professionals to adjust their methods for screening for Cushing’s disease in older adults.

“Improving our diagnostic sensitivity through our standardized assessments for the disease should account for these new findings,” Kim told Healio.

For more information:

Won Kim, MD, can be reached at wonkim@mednet.ucla.edu.

Published by:endocrine today logo

Cushing Disease Clinical Phenotype and Tumor Behavior Vary With Age

Abstract

Context

Little is known about presenting clinical characteristics, tumor biology, and surgical morbidity of Cushing disease (CD) with aging.

Objective

Using a large multi-institutional data set, we assessed diagnostic and prognostic significance of age in CD through differences in presentation, laboratory results, tumor characteristics, and postoperative outcomes.

Methods

Data from the Registry of Adenomas of the Pituitary and Related Disorders (RAPID) were reviewed for patients with CD treated with transsphenoidal tumor resection at 11 centers between 2003 and 2023. Outcomes assessed included comorbidities, presenting features, preoperative endocrine evaluations, perioperative characteristics, postoperative endocrine laboratory values, and complications.

Results

Of the 608 patients evaluated, 496 (81.6%) were female; median age at surgery was 44 years (range, 10-78 years). Increasing age was associated with increasing comorbidities, frailty, rates of postoperative thromboembolic disease, Knosp grade, tumor size, and postoperative cortisol and adrenocorticotropin nadirs. Conversely, increasing age was associated with decreased hallmark CD features, preoperative 24-hour urinary free cortisol, Ki-67 indices, and arginine vasopressin deficiency. Younger patients presented more frequently with weight gain, facial rounding/plethora, abdominal striae, hirsutism, menstrual irregularities, dorsocervical fat pad, and acne. Obstructive sleep apnea and infections were more common with increasing age.

Conclusion

There are age-dependent differences in clinical presentation, tumor behavior, and postoperative outcomes in patients with CD. Compared to younger patients, older patients present with a less classic phenotype characterized by fewer hallmark features, more medical comorbidities, and larger tumors. Notably, age-related differences suggest a more indolent tumor behavior in older patients, potentially contributing to delayed diagnosis and increased perioperative risk. These findings underscore the need for tailored diagnostic and therapeutic approaches across age groups, with a focus on managing long-term comorbidities and optimizing surgical outcomes.

Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Abstract

Objective

Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.

Methods

Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.

Results

In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.

Conclusion

Although the USP8EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Peer Review reports

Introduction

Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [34].

The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.

Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.

Methods

Case series

Study population

Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.

DNA extraction and Sanger sequencing

A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.

Systematic review

Overview of the systematic literature review

We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.

Search strategy

We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.

Inclusion and exclusion criteria

All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.

Results

Case series

Baseline characteristics of the participants

This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).

Frequency of USP8 gene variants

Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).

Fig. 1

figure 1

Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II

Clinical outcomes after surgery

All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).

Systematic review

The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.

Fig. 2
figure 2

Flow diagram of literature search and study selection

In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).

Table 1 Results of systematic literature review
Fig. 3

figure 3

Summary of USP8 mutations in patients with CD in selected studies

USP8 variants and the related pathways in corticotroph adenomas

In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].

Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].

Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].

A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].

DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].

Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma

Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].

In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].

A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].

USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma

Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].

In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].

A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].

Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].

Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].

The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].

Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].

Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].

Analytical conclusion

In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.

We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.

Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [615]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.

Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.

Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [724]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].

There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.

Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22252830]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [242742]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.

There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [3031]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [3738].

In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Data availability

The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.

Abbreviations

ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48

References

  1. Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.

  2. Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.

    Article CAS PubMed PubMed Central Google Scholar

  3. Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.

    Article CAS PubMed Google Scholar

  4. Mallari RJ, Thakur JD, Barkhoudarian G, Eisenberg A, Rodriguez A, Rettinger S, Cohan P, Nieman L, Kelly DF. Diagnostic pitfalls in Cushing Disease: Surgical Remission Rates, Test Thresholds, and lessons learned in 105 patients. J Clin Endocrinol Metab. 2022;107(1):205–18.

    Article PubMed Google Scholar

  5. Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.

    Article PubMed Google Scholar

  6. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.

    Article CAS PubMed Google Scholar

  7. Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.

    Article CAS PubMed PubMed Central Google Scholar

  8. Rebollar-Vega RG, Zuarth-Vázquez JM, Hernández-Ramírez LC. Clinical spectrum of USP8 pathogenic variants in Cushing’s Disease. Arch Med Res. 2023;54(8):102899.

    Article CAS PubMed Google Scholar

  9. Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.

    Article CAS PubMed PubMed Central Google Scholar

  10. Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.

    Article PubMed Google Scholar

  11. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.

    Article CAS PubMed PubMed Central Google Scholar

  12. Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.

  13. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.

    Article CAS PubMed Google Scholar

  14. Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.

    Article CAS PubMed Google Scholar

  15. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.

    Article CAS PubMed PubMed Central Google Scholar

  16. Martins CS, Camargo RC, Coeli-Lacchini FB, Saggioro FP, Moreira AC, de Castro M. USP8 mutations and cell cycle regulation in Corticotroph Adenomas. Horm Metab Res. 2020;52(2):117–23.

    Article CAS PubMed Google Scholar

  17. Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.

    Article CAS PubMed Google Scholar

  18. Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.

    Article CAS PubMed Google Scholar

  19. Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.

    Article PubMed PubMed Central Google Scholar

  20. Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.

    Article PubMed Google Scholar

  21. Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.

    Article PubMed Google Scholar

  22. Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.

    Article CAS PubMed PubMed Central Google Scholar

  23. Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.

    Article PubMed PubMed Central Google Scholar

  24. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.

  25. Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.

    Article CAS PubMed Google Scholar

  26. Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.

    Article CAS PubMed PubMed Central Google Scholar

  27. Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.

    Article CAS PubMed Google Scholar

  28. Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.

    Article CAS PubMed PubMed Central Google Scholar

  29. Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.

    Article CAS PubMed Google Scholar

  30. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.

    Article CAS PubMed Google Scholar

  31. Albani A, Perez-Rivas LG, Tang S, Simon J, Lucia KE, Colón-Bolea P, Schopohl J, Roeber S, Buchfelder M, Rotermund R, et al. Improved pasireotide response in USP8 mutant corticotroph tumours in vitro. Endocr Relat Cancer. 2022;29(8):503–11.

    Article CAS PubMed Google Scholar

  32. Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.

    Article CAS PubMed PubMed Central Google Scholar

  33. Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.

    Article CAS PubMed PubMed Central Google Scholar

  34. Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.

  35. Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.

    Article CAS PubMed Google Scholar

  36. Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.

    Article PubMed PubMed Central Google Scholar

  37. Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.

    Article CAS PubMed PubMed Central Google Scholar

  38. Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.

    Article CAS PubMed Google Scholar

  39. Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, Serban A, Ferrante E, Locatelli M, Lania AG, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. 2021;28(8):573–82.

    Article CAS PubMed Google Scholar

  40. Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.

    Article PubMed Google Scholar

  41. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.

    CAS PubMed Google Scholar

  42. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S. Transforming growth factor-alpha stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol. 2000;165(2):493–501.

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank all the participants enrolled in this study.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.

Author information

Author notes

  1. Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.

Authors and Affiliations

  1. Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran

    Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh

  2. Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran

    Ali Zare Mehrjardi

  3. Department of Endocrinology, Arad Hospital, Tehran, Iran

    Mahmoud Reza Kaynama

Contributions

Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad E. Khamseh.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Skip to figshare navigation

Below is the link to the electronic supplementary material.

Cite this article

Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord 24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z

Download citation

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable linkProvided by the Springer Nature SharedIt content-sharing initiative

Keywords

From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-024-01619-z