Recordati scores FDA nod for Cushing’s disease med—and Novartis castoff—Isturisa

Recordati’s Isturisa is expected to launch in the second or third quarter. (Getty)

As part of a small 2019 deal, Italian drugmaker Recordati snagged a trio of underperforming Novartis endocrinology meds, including a late-stage candidate for Cushing’s disease. Less than a year later, that drug is cleared for market after an FDA green light.

The FDA on Friday approved Recordati’s Isturisa (osilodrostat) to treat Cushing’s disease—a rare disease in which patients’ adrenal glands produce too much cortisol—in those who have undergone a prior pituitary gland surgery or are not eligible for one.
Isturisa, a cortisol synthesis inhibitor, will come with the FDA’s orphan drug designation, providing market exclusivity for seven years, Recordati said (PDF) in a release. The drug is expected to be commercially available in the second or third quarter.

The FDA based its review on phase 3 data showing 86% of patients treated with Isturisa showed normal cortisol levels in their urine after eight weeks, compared with 29% of patients treated with placebo, the drugmaker said.

Recordati is “actively building its commercial, medical, and market access teams” to accommodate Isturisa’s launch through its recently created U.S. endocrinology business unit, it said. The drugmaker will launch the drug with a “comprehensive distribution model” through specialty pharmacies.

Novartis, once the owner of Isturisa, turned the asset over to Recordati in 2019 as part of a $390 million offload of some of the Swiss drugmaker’s endocrinology portfolio.

Recordati received Signifor, long-acting sister Signifor LAR and Isturisa, positioned as a successor drug to Signifor. The purchase included milestone payments tied to Isturisa.

Recordati talked up the buy of the Cushing’s disease trio as a boon for its rare disease portfolio, calling it a “key and historical milestone” at the time.

From https://www.fiercepharma.com/pharma/recordati-scores-fda-nod-for-cushing-s-disease-med-isturisa

 

TP53 Mutations in Functional Corticotroph Tumors Are Linked to Invasion and Worse Clinical Outcome

Abstract

Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease.

Introduction

Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7].

Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [1920].

TP53 is the most commonly mutated gene in malignant neoplasms [2122], including brain and neuroendocrine tumors [2324]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [81625,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [1719].

To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features.

Methods

Patients and samples

We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9121317]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months).

Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation.

The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5].

DNA extraction, TP53 amplification and sequencing

Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [912]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [912]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system.

Statistical analysis

Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant.

Results

Analysis of TP53 nucleotide variants

We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison.

We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing.

Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33].

Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors

Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9).

The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3).

Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup.

Clinical presentation of patients with TP53 mutant tumors

Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4).

Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months).

We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2).

The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127).

Fig. 1

figure 1

Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis

Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B).

No statistical association was found between clinical data and any of the 8 common variants.

Characteristics of TP53 mutant corticotroph tumors

All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018).

Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups

Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4).

Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type).

We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells.

Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4).

Discussion

Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [81819].

Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [911131836]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [1719].

Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course.

Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [2938]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19].

A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation.

In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [1920]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development.

A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43].

In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [4445]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely.

Conclusion

Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome.

Availability of data and materials

The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request.

Abbreviations

CD:
Cushing’s disease
BADX:
Bilateral adrenalectomy
CTP-BADX/NS:
Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome
ACTH:
Adrenocorticotropic hormone
SD:
Standard deviation
IQR:
Interquartile range
HR:
Hazard ratio

References

  1. Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86

    PubMed PubMed Central Article Google Scholar

  2. McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276

    CAS PubMed Article Google Scholar

  3. Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875

    PubMed Article Google Scholar

  4. Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292

    PubMed Article CAS Google Scholar

  5. Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16

    CAS PubMed PubMed Central Article Google Scholar

  6. Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537

    Article Google Scholar

  7. Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75

    CAS PubMed Article Google Scholar

  8. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38

    CAS PubMed Article Google Scholar

  9. Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004

    PubMed PubMed Central Article Google Scholar

  10. Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317

    CAS PubMed PubMed Central Article Google Scholar

  11. Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226

    CAS PubMed Article Google Scholar

  12. Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65

    Article Google Scholar

  13. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458

    CAS Article Google Scholar

  14. Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851

    CAS PubMed Article Google Scholar

  15. Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259

    CAS PubMed PubMed Central Article Google Scholar

  16. Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171

    PubMed PubMed Central Article CAS Google Scholar

  17. Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283

    CAS PubMed PubMed Central Article Google Scholar

  18. Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5

    CAS PubMed Article Google Scholar

  19. Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842

    PubMed Article Google Scholar

  20. Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194

    PubMed Article Google Scholar

  21. Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93

    Article CAS Google Scholar

  22. Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876

    CAS PubMed Article Google Scholar

  23. Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508

    CAS PubMed PubMed Central Article Google Scholar

  24. van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612

    PubMed PubMed Central Article CAS Google Scholar

  25. Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55

    CAS PubMed Google Scholar

  26. Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814

    CAS Article Google Scholar

  27. Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222

    CAS PubMed Article Google Scholar

  28. Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657

    Article Google Scholar

  29. Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135

    PubMed Article Google Scholar

  30. Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/

  31. Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443

    CAS PubMed PubMed Central Article Google Scholar

  32. Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947

    CAS PubMed Article Google Scholar

  33. Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429

    CAS PubMed PubMed Central Article Google Scholar

  34. Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981

    CAS PubMed Article Google Scholar

  35. Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097

    CAS PubMed Google Scholar

  36. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129

    CAS PubMed Article Google Scholar

  37. Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24

    CAS PubMed Article Google Scholar

  38. Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70

    CAS PubMed Article Google Scholar

  39. Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272

    CAS PubMed Article Google Scholar

  40. Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16

    Google Scholar

  41. Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404

    PubMed Article Google Scholar

  42. Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87

    CAS PubMed Article Google Scholar

  43. Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8

    Article Google Scholar

  44. Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157

    CAS PubMed Article Google Scholar

  45. Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492

    CAS PubMed PubMed Central Article Google Scholar

  46. Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416

    CAS PubMed PubMed Central Article Google Scholar

  47. Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365

    CAS PubMed Article Google Scholar

  48. Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243

    CAS PubMed PubMed Central Article Google Scholar

  49. Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90

    CAS PubMed PubMed Central Article Google Scholar

  50. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861

    CAS PubMed PubMed Central Article Google Scholar

Download references

Funding

Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG).

Author information

Authors and Affiliations

  1. Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyLuis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou
  2. Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, GermanySigrun Roeber & Jochen Herms
  3. Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, FranceGuillaume Assié
  4. Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, FranceGuillaume Assié
  5. Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, GermanyTimo Deutschbein & Martin Fassnacht
  6. Medicover Oldenburg MVZ, Oldenburg, GermanyTimo Deutschbein
  7. Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, BrazilMonica R. Gadelha
  8. Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The NetherlandsAd R. Hermus
  9. Medicover Neuroendocrinology, Munich, GermanyGünter K. Stalla
  10. Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, LuxembourgMaria A. Tichomirowa
  11. Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, GermanyRoman Rotermund & Jörg Flitsch
  12. Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, GermanyMichael Buchfelder
  13. Department of Neurosurgery, University of Tübingen, Tübingen, GermanyIsabella Nasi-Kordhishti & Jürgen Honegger
  14. Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, GermanyJun Thorsteinsdottir
  15. Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, GermanyWolfgang Saeger

Contributions

LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft.

Corresponding authors

Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou.

Ethics declarations

Ethics approval and consent to participate

The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome

Skip to file navigationSkip to generic navigation
1
Supplementary Table 1
. Description of study cohort.
Variable
mean/median
SD/IQR
Total n
Age at diagnosis (years), mean ±SD, [total n]
42
±15.2
86
Sex (female), n (%), [total n]
62
(72%)
86
BMI (kg/m2), mean ±SD, [total n]
28.9
±6.3
74
Disease presentation, n (%), [total n]
86
Cushing
66
(77%)
Nelson
20
(23%)
Number of prior pituitary surgeries, n (%), [total n]
80
0
50
(63%)
1
23
(29%)
≥2
7
(9%)
Total
number of pituitary surgeries, n (%), [total n]
82
1
46
(56%)
2
23
(28%)
≥3
13
(16%)
Complete tumor resection, n (%), [total n]
32
(60%)
53
Postoperative remission, n (%), [total n]
46
(59%)
78
Postoperative tumor control, n (%), [total
n]
34
(60%)
57
Radiation therapy, n (%), [total n]
24
(34%)
70
Radiation therapy before sample collection, n (%), [total n]
7
(13%)
53
Bilateral adrenalectomy, n (%), [total n]
23
(27%)
86
Pharmacological treatments
a
,
n (%), [total n]
18
(42%)
43
Preoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
98
(570.4)
75
Serum cortisol (
μ
g/dl), median (range)
29.1
(168.6)
50
24h
urinary free cortisol (
μ
g/24h), median (range)
432.5
(598.3)
30
Serum cortisol after low
dose DST (
μ
g/dl),
median (IQR)
20
(20.7)
46
Postoperative hormone levels
Plasma ACTH (pg/mL), median (IQR)
20
(107.6)
57
Serum cortisol nadir (
μ
g/dl), median (range)
8.8
(19.4)
58
Tumo
r size (mm), median (IQR), [total n]
15
(13.0)
85
Microadenoma
19
(22%)
Macroadenoma
66
(78%)
Granulation, n (%), [total n]
30
Sparsely
9
(30%)
Densely
21
(70%)
Ki67 index, median (IQR), [total n]
2.0
(3.8)
36
Ki67 index ≥3%, n (%)
14
(39%)
36
p53 positivity, median (IQR), [total n]
1
(26.5)
9
Invasion, n (%),
[total n]
34
(53%)
64
Hardy grade, n (%), [total n]
61
1
13
(21%)
2
22
(36%)
3
18
(30%)
4
8
(13%)
Knosp grade, n (%), [total n]
35
0
5
(14%)
1
12
(34%)
2
3
(9%)
3
7
(20%)
4
8
(7%)
Disease
specific death, n (%), [total
n]
5
(9%)
58
a
Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide
(n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1
pharmacological agent.
2
Supplementary Table 2
. Primers used for
TP53
amplification and Sanger sequencing.
Primer
Sequence
DNA source
TP53
1
5′
TCTCATGCTGGATCCCCACT
3′
FF, FFPE
TP53
1rv
5′
GACCAGGTCCTCAGCC
3′
FFPE
TP53
2fw
5′
GGGGGCTGAGGACCTGGT
3′
FFPE
TP53
2rv
5′
ATACGGCCAGGCATTGAAGT
3′
FFPE
TP53
2
5′
AGAGGAATCCCAAAGTTCCA
3′
FF
TP53
3
5′
GTGCCCTGACTTTCAACTC
3′
FF, FFPE
TP53
3rv
5′
GGCAACCAGCCCTGTC
3′
FFPE
TP53
4fw
5′
GCCTCTGATTCCTCACTGAT
3′
FFPE
TP53
4
5′
CAGGAGAAAGCCCCCCTACT
3′
FF, FFPE
TP53
5
5′
CTTGCCACAGGTCTCCCCAA
3′
FF, FFPE
TP53
6
5′
AGGGGTCAGAGGCAAGCAGA
3′
FF, FFPE
TP53
7
5′
TAGGACCTGATTTCCTTA
3′
FF, FFPE
TP53
7rv
5′
AGTGAATCTGAGGCATAAC
3′
FFPE
TP53
7Bfw
5′
TGGAGGAGACCAAGGGTG
3′
FFPE
TP53
7Brv
5′
CGGCATTTTGAGTGTTAGAC
3′
FFPE
TP53
8
5′
TAAGCTATGATGTTCCTTAG
3′
FF, FFPE
TP53
8rv
5′
GACTGTTTTACCTGCAATTG
3′
FFPE
TP53
9
5′
CAATTGTAACTTGAACCATC
3′
FF, FFPE
TP53
10
5′
GGATGAGAATGGAATCCTAT
3′
FF, FFPE
TP53
11
5′
TCTCACTCATGTGATGTCATC
3′
FF, FFPE
TP53
12
5′
CACACCTATTGCAAGCAAGG
3′
FF, FFPE
FF, fresh frozen; FFPE, formalin
fixed
paraffin embedded.

Additional file 1

Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS.

 

Osilodrostat normalizes urinary free cortisol in Cushing’s disease for most at 72 weeks

More than 80% of adults with Cushing’s disease receiving osilodrostat had normalized mean urinary free cortisol levels at 72 weeks of treatment, according to findings from the LINC 3 study extension.

“Cushing’s disease is a chronic condition, and many patients require prolonged pharmacological treatment. Therefore, evaluating long-term efficacy and safety of drug therapies in clinical trials is essential,” Maria Fleseriu, MD, FACE, professor of medicine and neurological surgery and director of the Pituitary Center at Oregon Health & Science University in Portland and a Healio | Endocrine Today co-editor, told Healio. “Our findings build on the positive results of the LINC 3 study core phase, and it was reassuring to see that continued treatment with osilodrostat for over 72 weeks provided long-term normalization of cortisol levels. Furthermore, continued treatment with osilodrostat also led to sustained improvements in clinical signs and physical manifestations of hypercortisolism, as well as health-related quality of life, which are all important factors in the management of these patients.”

Fleseriu and colleagues enrolled 106 adults with Cushing’s disease who were responders to osilodrostat (Isturisa, Recordati) at 48 weeks during the LINC 3 core study to enter the extension phase of the trial. Participants continued to receive open-label osilodrostat until 72 weeks or treatment discontinuation. Mean urinary free cortisol was collected every 12 weeks. Physical manifestations of hypercortisolism were rated at 48 and 72 weeks. Participants completed the Cushing’s Quality of Life questionnaire and Beck Depression Inventory II at 48 and 72 weeks. Adults were deemed to have completely responded to treatment if mean urinary free cortisol was less than the upper limit of normal and partially responded to treatment if mean urinary free cortisol was above the upper limit of normal but decreased more than 50% from baseline.

The findings were published in the European Journal of Endocrinology.

Of the 106 participants in the extension study, 98 completed 72 weeks of treatment. At 72 weeks, 81.1% of participants were complete responders to treatment, and reductions in mean urinary free cortisol from the core phase were maintained during the extension.

Improvements in most cardiovascular and metabolic-related parameters from the core study were maintained or improved in the extension phase. The cohort also had increases in quality of life score and improvements in Beck Depression Inventory II scores.

The proportion of participants with improvements in physical manifestation of hypercortisolism were maintained or improved in all areas at 72 weeks. For hirsutism in women, 86.4% had an improved or stable severe score at 72 weeks. Improved scores were observed in participants with mild, moderate and severe physical manifestations at baseline with few adults experiencing worse manifestations at the end of the extension study.

There were no new safety signals reported in the extension study. Of the extension study participants, 11.3% discontinued osilodrostat due to adverse events, a similar percentage to the 10.9% discontinuation rate during the core phase of the study.

Several hormone concentrations, including mean adrenocorticotropic hormone, 11-deoxycortisol and plasma aldosterone, stabilized during the extension phase after changes were observed in the core study compared with baseline. Mean testosterone in women decreased from 2.6 nmol/L at 48 weeks to 2.1 nmol/L at 72 weeks. There were no changes observed in mean testosterone levels for men.

“Patients should be regularly monitored and osilodrostat dose titrated as necessary, alongside adjustment of concomitant medications, to optimize outcomes,” the researchers wrote. “Taken together, these findings support osilodrostat as an effective and well-tolerated long-term treatment option for patients with Cushing’s disease.”

For more information:

Maria Fleseriu, MD, FACE, can be reached at fleseriu@ohsu.edu.

From https://www.healio.com/news/endocrinology/20220914/osilodrostat-normalizes-urinary-free-cortisol-in-cushings-disease-for-most-at-72-weeks

Unmet needs in Cushing’s Syndrome: the Patients

Abstract

Background

Cushing’s syndrome (CS) is a rare condition of chronically elevated cortisol levels resulting in diverse comorbidities, many of which endure beyond successful treatment affecting the quality of life. Few data are available concerning patients’ experiences of diagnosis, care and persistent comorbidities.

Objective

To assess CS patients’ perspectives on the diagnostic and care journey to identify unmet therapeutic needs.

Methods

A 12-item questionnaire was circulated in 2019 by the World Association for Pituitary Organisations. A parallel, 13-item questionnaire assessing physician perceptions on CS patient experiences was performed.

Results

Three hundred twenty CS patients from 30 countries completed the questionnaire; 54% were aged 35–54 and 88% were female; 41% were in disease remission. The most burdensome symptom was obesity/weight gain (75%). For 49% of patients, time to diagnosis was over 2 years. Following treatment, 88.4% of patients reported ongoing symptoms including, fatigue (66.3%), muscle weakness (48.8%) and obesity/weight gain (41.9%). Comparisons with delay in diagnosis were significant for weight gain (P = 0.008) and decreased libido (P = 0.03). Forty physicians completed the parallel questionnaire which showed that generally, physicians poorly estimated the prevalence of comorbidities, particularly initial and persistent cognitive impairment. Only a minority of persistent comorbidities (occurrence in 1.3–66.3%; specialist treatment in 1.3–29.4%) were managed by specialists other than endocrinologists. 63% of patients were satisfied with treatment.

Conclusion

This study confirms the delay in diagnosing CS. The high prevalence of persistent comorbidities following remission and differences in perceptions of health between patients and physicians highlight a probable deficiency in effective multidisciplinary management for CS comorbidities.

Introduction

Cushing’s syndrome (CS) is a morbid endocrine condition due to prolonged exposure to high circulating cortisol levels (123). Hypercortisolism may cause irreversible physical and psychological changes in several tissues, leading to debilitating morbidities which persist over the long term after the resolution of excessive hormone levels, such as cardiovascular complications, metabolic and skeletal disorders, infections and neuropsychiatric disturbances (34). Even patients who have been biochemically ‘cured’ for over 10 years have a residual overall higher risk of mortality, mostly from circulatory disease and diabetes (5). Moreover, people with a history of CS suffer from impaired quality of life (QoL) (6). Several studies suggest that the prevalence of persistent comorbidities is correlated with the duration of exposure to cortisol excess (78). However, as the signs and symptoms of CS overlap with common diseases such as the metabolic syndrome and depression, the time taken to diagnose CS is often long, resulting in a significant number of patients with persistent sequelae and impairments in QoL (69).

Given the burden of the disease, ideal CS treatment would include early diagnosis, curative surgery and multidisciplinary care of comorbidities both pre- and post-cure of CS, including the psychological dimension of the patient’s disease experience (10). Few data are available about patients’ perceptions of the medical journey from first symptoms to diagnosis, treatment and follow-up. The aim of this study was, therefore, to explore CS patients’ experiences of symptoms, diagnosis, care and treatment satisfaction around the world and to compare patients’ perceptions of CS with those of physicians.

Methods

Patient questionnaire design

A 12-item patient questionnaire was developed based on the generally understood clinical characteristics and symptomology of CS, aiming to assess patients’ experiences of symptoms, diagnosis, care and treatment satisfaction (12) (Supplementary File 1, see section on supplementary materials given at the end of this article). The questionnaire was initially offered in English and made available via the SurveyMonkey online platform from March to May 2019. The survey was completed anonymously and required no specific participant identification or any details that could be used to identify individual participants. In addition to basic demographics (i.e. country of residence, sex, age and highest educational level attained), the questionnaire asked ten multiple-choice and two open questions. The survey was shared by the World Association for Pituitary Organisations (WAPO), Adrenal Net, Cushing’s Support & Research Foundation and the Pituitary Foundation, as well as being distributed to local patient associations. As a second step, the questionnaire was translated into eight additional languages (French, Dutch, Spanish, Chinese, Portuguese, Italian and German) and was recirculated by the WAPO, Adrenal Net and China Hypercortisolism Patient Alliance to the different local patient associations for distribution in November 2019. As this was a non-interventional, anonymous patient survey, distributed by the patient associations themselves, and not initiated or funded by a research or educational institution, no ethical review was required. Written consent was obtained from each respondent after full explanation of the purpose and nature of the survey.

Comparative physician survey

In addition, a 13-item physician questionnaire was developed to assess physicians’ perspectives on CS symptoms and comorbidities. This physician questionnaire was conducted by HRA Pharma Rare Diseases at the 2019 European Congress of Endocrinology, in Lyon, France. This anonymous questionnaire was completed by 40 qualified physicians. The responses from the patient survey were compared for context with the physicians’ estimates of the prevalence of CS symptoms and comorbidities. Although the physician questionnaire was conducted independently of the patient questionnaire, and used a different question structure, the comparison with the current patient questionnaire is included to further enrich and contextualise the patient responses.

Data analysis

All responses and answers were collected, coded and analysed using Microsoft Excel. Data preparation involved removing duplicate answers, or where possible analysing and reclassifying qualitative responses reported as ‘other’, based on the accompanying details to new or existing response options.

Statistical methodology

Complementary statistical analyses using SAS software were performed using the chi-square and Fisher tests, depending on the cell counts, to compare (i) the time between first symptoms and diagnosis and the persistence of symptoms and (ii) persistence of symptoms, with the specialities of the physicians currently treating the respondents. Frequency distribution of a particular variable was displayed and compared with the frequency distribution of the comparator variable. A significance level of 0.05 was applied.

Results

Demographic characteristics

Three hundred twenty patients from 30 countries completed the patient questionnaire, with 27% (n  = 87) coming from the United Kingdom and 14% (n  = 44) from the United States of America. More than half (53.7%, n = 172) of the patients were aged between 35 and 54 years, and 88.4% (n  = 283) were female. The majority of patients (53.1%, n = 170) had undergraduate or postgraduate qualifications (Table 1).

Table 1Patient demographics.

Sex N = 319a
 Female 283 (88.4%)
 Male 36 (11.3%)
Age group N = 320
 18–24 years 16
 25–34 years 49
 35–44 years 71
 45–54 years 101
 55–64 years 54
 65–74 years 24
 ≥75 years 5
Regionb N = 320
 Western Europe 222
 North America 60
 China 16
 Australasia 14
 South America 5
 Africa 3
Education N = 320
 High school graduate/secondary education diploma 35%
 Undergraduate degree 25.6%
 Post-graduate degree 27.5%
 Prefer not to say 10.6%
Time from first symptoms to diagnosis N = 320
 0–6 months 18.4%
 6–12 months 15.6%
 1–2 years 14.4%
 2–3 years 18.4%
 3–5 years 11.6%
 5–10 years 8.4%
 10–15 years 7.5%
 15–20 years 0.9%
 20+ years 1.9%
 Unknown 2.8%

aOne patient responded ‘non-binary’. bWestern Europe: United Kingdom (n  = 87), the Netherlands (n  = 38), France (n  = 37), Spain (n  = 12), Denmark (n  = 10), Norway (n  = 9), Germany (n  = 6), Italy (n  = 5), Ireland (n  = 4), Belgium (n  = 4), Poland (n  = 4), Sweden (n  = 2), Malta (n  = 2), Switzerland (n  = 1), Czech Republic (n  = 1); Africa: South Africa (n  = 1), Gabon (n  = 1), Zimbabwe (n  = 1); Australasia: Australia (n  = 8), New Zealand (n  = 6); South America: Colombia (n  = 2), Bolivia (n  = 1), Argentina (n  = 1), Brazil (n  = 1); North America: United States of America (n  = 44), Canada (n  = 13), Costa Rica (n  = 1), Mexico (n  = 1), Dominican Republic (n  = 1).

Time to diagnosis

The time to diagnosis from first reporting of CS symptoms was declared to be within 2 years for 48.4% (n  = 155) (Table 1) and was over 2 years in 48.7% (n  = 156) and over 3 years in 30.3% (n  = 97).

Initial symptoms

A broad range of signs and symptoms were initially noticed by patients, with weight gain, hirsutism or acne, fatigue, sleep disturbances, depressive symptoms, muscle weakness, anxiety and hypertension all being reported in over 50% of patients (Table 2). Obesity/weight gain was most commonly cited (75%, n = 240) as being burdensome. Fatigue, feelings of depression or mood problems, sleep disturbances, muscle weakness and hirsutism were also very commonly (>40%) mentioned as being burdensome. Burdensome symptoms classified as ‘other’ were rare (<1%) and included issues such as hormonal problems and dental problems.

Table 2Patient-reported symptoms (multiple answers were possible).

Symptoms first noticed (%) Most burdensome perceived symptoms before diagnosis (%)
Weight gain 85.0 75.0
Hirsutism/acne 76.3 42.8
Fatigue 66.3 54.1
Sleep disturbances 64.4 41.9
Skin problems 64.7 21.3
Depression/mood problems 58.8 48.1
Muscle weakness 57.8 43.4
Anxiety 54.1 39.1
Hypertension 52.5 22.2
Loss of concentration 45.0 28.4
Memory problems 41.9 30.3
Menstrual disturbances 35.6 12.5
Decreased libido 32.5 12.5
Bone problems 23.1 14.4
Infections 23.8 10.3
Glucose intolerance 17.2 8.4
Blood clot 5.3
Pain(s) 3.1
Vision problems 2.8
Headache 2.5
Cravings 1.6
Other 8.4 1.9

Person who made the initial CS diagnosis

In 53.8% (n  = 172) of cases, an endocrinologist made the initial diagnosis of CS or prescribed the first screening tests, Table 3. General practitioners made 18.1% of diagnoses (n  = 58), in the remaining cases a diversity of other physicians directly or indirectly contributed to make the diagnosis, as indicated in Table 3. A small but noticeable number (5.6%, n = 18) of patients self-diagnosed and then convinced their physician to order the diagnostic tests.

Table 3Patient perception of physician specialty.

Specialty Person who made the initial diagnosis or suspected Cushing’s syndrome (%) (n = 320) Physicians involved in the management of Cushing’s syndrome (%) (n = 320)
Endocrinologist 53.8 97.8
General practitioner/family doctor 18.1 56.3
Self-diagnosed 5.6
Hospital/emergency doctor 3.8
Internist 2.5 0.9
Gynecologist 1.9 14.1
Cardiologist 1.9 13.4
Bone specialist 1.9 14.1
Dermatologist 1.6 11.6
Haematologist 0.9 3.8
Ophthalmologist 0.9 3.1
Nurse 0.9 2.5
Radiologist 0.9 0.6
Family or friend 0.9
Psychiatrist or psycologist 0.9 23.4
Healer 0.6 2.2
Surgeon 0.6
Oncologist 0.3 6.6
Gastroenterologist 0.3 1.3
Neurologist 0.3 4.1
Others 1.6
Physiotherapist 14.4
Dietician 9.7
Neurosurgeon 8.1
Social worker 4.1
Ear, nose and throat specialist 1.6
Sports physician 1.3
Sleep specialist 0.9
Urologist 0.6
Orthopaedic surgeon 0.3

Response to treatment

At the time of answering the questionnaire, 55.8% (n  = 178) of patients were not in remission. 40.8% of patients (n  = 130) were in true biochemical remission (Fig. 1). This latter group was a composite including patients who responded: ‘In remission (no treatment)’ (16.3%, n = 52), ‘Received an operation to remove adrenal glands’ (22.9%, n = 73) and ‘Treated with hydrocortisone’ (1.6%, n = 5). Thirteen percent of the patients (n  = 41) were on cortisol-lowering treatment and 6.6% of the patients (n  = 21) had not had or were awaiting surgery. Following treatment for CS, 11.6% of the patients (n  = 37) reported having no further symptoms related to the condition, with 88.4% (n  = 283) still symptomatic. Of the total population (n  = 320), the most bothersome symptoms were fatigue (66.3%, n = 212), muscle weakness (48.8%, n = 156) and obesity/weight gain (41.9%, n = 134) (Table 4).

Figure 1View Full Size
Figure 1
Patient description of their current clinical situation (n = 319). The category ‘Disease in true remission’ combines scores for ‘In remission (no treatment)’ (16.3%), ‘Received an operation to remove adrenal glands’ (22.9%) and ‘Treated with hydrocortisone’ (1.6%). One person did not complete the question.

Citation: Endocrine Connections 11, 7; 10.1530/EC-22-0027

Table 4Persistent symptoms.

Symptom Persistent bothersome symptomsa (%) (n = 320) Treatment received for symptoms (%) (n = 320)
Fatigue 66.3 15.9
Muscle weakness 48.8 17.2
Weight gain 41.9 8.4
Depression, mood problems 36.9 28.8
Poor concentration 35.9 4.1
Memory problems 33.8 5.6
Sleep problems 33.1 14.1
Anxiety 30.6 14.7
Decreased libido 25.3 4.1
Bone problems 19.1 21.9
Hypertension 18.4 29.4
Hirsutism 17.5 4.1
Skin problems 16.6 6.9
Glucose intolerance 8.8 10
Menstrual problems 9.1 4.7
Infections 7.2 4.7
Blood clot 3.8 2.2
Acne 2.8 1.3
Other 4.4 5.3
No treatment 1.3 8.1
Only hydrocortisone 1.6

aUp to five answers were possible.

Comparison of time to diagnosis and persistence of symptoms

To compare the time to diagnosis and the persistence of symptoms following treatment, an analysis of a number of variables was performed comparing the group with persistent symptoms after treatment (n  = 283) with those who did not (n  = 37) in terms of time to diagnosis. Patients with a longer time to diagnosis reported significantly more frequent weight gain (P = 0.008), and more frequent reduced libido (P = 0.03) after treatment. Although not statistically significant, there was a strong trend towards patients reporting a longer time to diagnosis and a greater frequency of persistent perceived bone issues after treatment (P = 0.053), as well anxiety (P = 0.07) and depression/mood concerns (P = 0.08).

Physicians involved in follow-up

Once diagnosed, almost all patients (97.8%, n = 313) were managed by an endocrinologist, followed by a GP/family doctor (56.3%, n = 180). A psychiatrist/psychologist was involved in 23.4% (n  = 75), followed by a physiotherapist (14.4%, n = 46), rheumatologist (14.4%, n = 46), gynecologist (14.1%, n = 45), cardiologist (13.4%, n = 43), dermatologist (11.6%, n = 37) and a dietician (9.7%, n = 31) (Table 3).

Treatment of persistent symptoms

Table 4 shows the prevalence of persistent symptoms after treatment, common ongoing comorbidities included fatigue, muscle weakness and weight gain. The percentage of patients who were treated for comorbidities is also shown. Noticeable undertreatment occurred for many symptoms, for example, fatigue was a consistent symptom for 66.3% (n  = 212), whereas only 15.9% (n  = 51) were receiving ongoing care for fatigue and persistent muscle weakness was reported in 48.8% (n  = 156) with 17.2% (n  = 55) of patients being treated for this (Table 4).

The high frequency of persistent symptoms suggests that patients were not followed-up by specific specialists, for example of the 212 patients with persistent fatigue, only 60 (28.2%) were seeing a psychiatrist/psychologist (Table 4). Enduring poor concentration and memory problems were relatively frequent (35.9%, 33.8%) but were rarely treated by a specialist (4.1 and 5.6%, respectively).

Three-quarters of patients reported that their work life had been affected (75%, n = 240). Social life (65.3%, n = 209), family life (57.8%, n = 185), interpersonal relationships (51.6%, n = 165), and sexual life (48.8%, n = 155) had also been significantly affected by their illness. Thirty-seven percent of the patients (n  = 118) reported that their economic situation had been negatively affected. ‘Other’ responses for this question included reductions in self-esteem, self-image and self-confidence. Sixty-three percent of patients (193/305) were satisfied with their treatment and 36.7% (n  = 112) were not.

Comparative analysis physician questionnaire

In the complementary physician questionnaire (n  = 40), unlike the patient questionnaire where most respondents were from the United Kingdom, the United States of America, the Netherlands and France, most of the physicians surveyed were from Western Europe, although there were representatives from other parts of the world. In the physician questionnaire, 83% (n  = 33) were endocrinologists, 13% (n  = 5) internal medicine specialists and 5% (n  = 2) other disciplines. Sixty percent (n  = 24) had over 10 years clinical experience, and 93% (n  = 37) were experienced in the treatment of CS, seeing an average of 10 patients per year. Of the specialities involved in the care of CS, 96% of physicians (n  = 38) considered endocrinologists to be involved, 48% (n  = 19) included family doctors/GPs, 20% (n  = 8) cardiologists, 28% (n  = 11) psychiatrists/psychologists and 28% (n  = 11) included dieticians. These results are consistent with the patients’ perceptions, with the exception of dieticians, who only 10% of patients reported seeing (Table 3).

Figure 2A compares the frequency of common symptoms that patients found to be most burdensome during the active phase of the disease, with what physicians thought were the most common symptoms. Although for methodological reasons a statistical comparison was not possible and the comparisons are approximate, these findings suggest that physicians’ perceptions of the prevalence of symptoms were different from those reported by patients. A majority of physicians (Fig. 2A) inadequately estimated (both underestimated and overestimated) the presence of depression, muscle weakness, cognitive impairment, hypertension, bone problems and glucose intolerance. Figure 2B compares the physician’s perception of the frequency of persistent symptoms with the patients’ experience of persistent symptoms. A majority of physicians differently estimated the prevalence of persistent cognitive impairment, muscle weakness, depressive symptoms and weight gain.

Figure 2View Full Size
Figure 2
(A) Physician (n = 40) perception of patient comorbidities (left) and patient reports of the most burdensome symptoms during active CS (right). (B) Physician (n = 40) perception of CS symptoms after cure (right) and patient reports of persistent burdensome symptoms after treatment (left). Only the relevant common results from the physician and patient surveys are shown above. The physician survey included categories ‘insulin resistance’, ‘dyslipidaemia’, ‘cardiovascular complications’ and ‘psychosis’, which are not shown because these same categories were not reported in the patient survey. In the patient survey, responses for the categories: ‘anxiety’ were regrouped with ‘depressive symptoms’ and ‘memory problems’ and ‘poor concentration’ were regrouped into the ‘cognitive impairment’ category for easier comparison with the physician survey.

Citation: Endocrine Connections 11, 7; 10.1530/EC-22-0027

Discussion

This large, international CS patient survey confirms previous findings that despite complaining of multiple symptoms, there is a mean 34-month delay in diagnosis (9). In addition, despite treatment resulting in biochemical remission, patients report persistent comorbidities with associated psychological and social impacts that negatively affect the QoL (1112). In the present survey a majority of patients reported that they are not being managed by the appropriate specialists, suggesting an absence in multidisciplinary care that may be secondary to an underestimation of the sequelae of CS by endocrinologists.

The present survey confirmed that no specific symptom initiated a diagnosis, but rather a range of burdensome symptoms occurring with similar frequency to those reported in previous surveys (12), with the notable difference in that in a USA-German survey, cognitive and psychological symptoms were bothersome for 61% of US and 66% of German patients (13), whereas in the present survey 38% considered depression/mood problems burdensome. Such differences may be a result of different terms being used to describe depression or mood symptoms as well as cultural differences between populations.

The distribution of time to diagnosis, with around 50% diagnosed after 2 years of symptoms and approximately 30% still undiagnosed after 3 years is of a similar magnitude to previous surveys, where 67% of patients waited at least 3 years until diagnosis (14). In the CSFR study in 2014, patients waited a median of 5 years until diagnosis (15). Even though the estimated time to diagnosis may be similar to those in previous studies – 34 months a recent meta-analysis (9) and 2 years in the ERCUSYN database (16) – there is clearly still room for improvement, especially as delayed diagnosis is associated with persistent comorbidities (9171819). Physicians should consider that in patients with diabetes, hypertension and osteoporosis hypercortisolism may be hidden (20). Due to the elevated incidence of mood and cognitive dysfunction at CS diagnosis, questioning the patient whether they feel that ‘something unusual is happening’ such as mood swings and sleeping disorders may be helpful, as a not insignificant proportion of patients self-diagnose CS (15).

Awareness of the clinical presentation patterns of CS should be increased among general practitioners but also in specialists other than endocrinologists. In the current survey, the low proportions of physiotherapists, neurologists, orthopaedic surgeons and psychiatrists identifying CS represent an educational opportunity to improve early diagnosis. It is for instance not widely known that venous thromboembolic events or fragility fractures can be a presenting symptom of CS (2021). It is encouraging that rheumatologists already recommend excluding occult endogenous hypercortisolism as a first cause of muscle weakness (22).

Multidisciplinary care is recommended for the ongoing management of patients after biochemical cure, with a particular emphasis on the QoL, depressive symptoms and anxiety (11). Specialist care is recommended for specific comorbidities, for example physiotherapists are required to help revert musculoskeletal impairment and prevent further deterioration (23), and bone specialists are required to manage the individual patient fracture risk according to the patient’s age and evolution of bone status after surgery (24). In the present survey, almost all patients were treated by endocrinologists and the role of specialists treating particular comorbidities was limited despite the ongoing complaints in patients. This is particularly evident in the high prevalence of muscle weakness, which was rarely managed by physiotherapists. This failure to provide multidisciplinary care may account for why nearly 40% of CS patients were dissatisfied with their treatment.

The exact number of patients with controlled hypercortisolism cannot be evaluated from the questionnaire. The degree of control of hypercortisolism remains debatable in patients treated with cortisol-lowering agents and may not be equivalent to remission following surgery (2526). In the present survey, the vast majority reported persistent and burdensome symptoms despite treatment, which is in line with previous reports of persistent low body satisfaction and high rates of depression and anxiety (27). When compared with longer time to diagnosis, the only comparisons that reached statistical significance were weight gain and decreased libido; whereas, there was a trend towards extended time to diagnosis and worsening of depressive symptoms and anxiety. These findings confirm the need for early diagnosis and treatment as the duration of exposure to hypercortisolism is a predictor of persistent morbidities and long-term impairments in the QoL (15).

Although the parallel physician perception questionnaire was limited by small size and methodological differences in comparison to the patient survey, the results suggest that physicians’ perceptions contrast with patients’ experiences. Physicians tended to underestimate weight gain and cognitive impairment during the active phase of the disease, and underestimate the prevalence of cognitive impairment, depressive symptoms and muscle weakness following treatment. A recent survey on physician vs patient perspectives on postsurgical recovery also highlighted important differences in perceptions, suggestive of poor communication (28). However, these comparisons are limited in that physicians’ estimations may be influenced by the clinical importance of certain symptoms, whereas for patients these may or may not be particularly onerous. Nevertheless, these findings do suggest that some symptoms do not receive enough attention, possibly due to insufficient awareness of these symptoms as real clinical problems.

The strength of this survey is that it includes a large and international population, whereas previous surveys tended to be carried out in individual countries. It informs the quantitative and qualitative understanding of CS patients’ experiences with their treatment journeys and highlights some important lacunae in the management of CS, as well as identifying some differences in physician and patient perceptions about the burden of CS comorbidities.

A limitation in the study design was the inability of the questionnaire to clearly distinguish a subgroup who were biochemically cured and had ongoing symptoms. Indeed, remission was based on patients’ declarations instead of an objective hormone assessment, which is an unavoidable limitation of online surveys. On the other hand, the survey was precisely designed to capture patients’ perceptions about their health status, regardless of having received a diagnosis of “remission” or not from their endocrinologist. Patients who had pituitary surgery were not considered as being “in remission” in order to mitigate the impact of this limitation on the final analysis. The major limitations of this survey also include its cross-sectional design, depending upon an individual assessment at a single time point and relying on patients’ memories. The comparison of the patient and doctor cohorts was limited by having different questionnaire methodologies and the lack of matching of patients and their endocrinologists. The questionnaire results could also not be corroborated against clinical records and no matched control group was assessed. Selection basis was another potential limitation, as patients were recruited through patient associations, which may have skewed the population towards patients with a higher disease burden; moreover, patients with chronic conditions who respond to questionnaires tend to have a low QoL (15).

Conclusion

This international cross-sectional study confirms that symptoms experienced by patients with CS are diverse, burdensome and endure beyond treatment (20). Delays in diagnosis may contribute to persistent symptoms after treatment. Care of patients with persistent comorbidities affecting the QoL (e.g. obesity, cognitive impairment, depression and muscle weakness) could be improved through more frequent multidisciplinary collaboration with healthcare professionals outside of endocrinology.

Supplementary materials

This is linked to the online version of the paper at https://doi.org/10.1530/EC-22-0027.

Declaration of interest

A T participated in research studies, received research grants and honorarium for talks at symposia and boards from HRA Pharma Rare Diseases, Pfizer, Novartis and Recordati Rare Diseases. C A participated in research studies and received honoraria for talks at symposia and participation in advisory boards from HRA Pharma Rare Diseases. E V participated in research studies and received honoraria for talks at symposia and participation in advisory boards from HRA Pharma Rare Diseases and Recordati Rare Diseases. I C is an investigator in studies using relacorilant (Corcept Therapeutics) in patients with hypercortisolism and has received consulting fees from Corcept Therapeutics and HRA Pharma Rare Diseases. R F has received research grants from Strongbridge and Recordati Rare Diseases and honoraria for talks at symposia and for participating in advisory boards from HRA Pharma Rare Diseases, Corcept, Ipsen, Novartis and Recordati Rare Diseases. M A H and S I are employees of HRA Pharma Rare Diseases. R A F is a member of the editorial board of Endocrine Connections. He was not involved in the editorial or review process of this paper, on which he is listed as an authors.

Funding

This work did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector.

Acknowledgements

The authors would like to thank all the patients involved who responded and the World Association for Pituitary Organisations (WAPO), Adrenal Net, China Hypercortisolism Patient Alliance, the Cushing’s Support & Research Foundation (CSRF) and the Pituitary Foundation for assisting with the distribution of the patient questionnaires. The authors would also like to gratefully acknowledge the contribution of the ApotheCom communications agency for helping to conduct this survey.

References

Persistent vs Recurrent Cushing’s Disease Diagnosed Four Weeks Postpartum

Abstract

Background. Cushing’s disease (CD) recurrence in pregnancy is thought to be associated with estradiol fluctuations during gestation. CD recurrence in the immediate postpartum period in a patient with a documented dormant disease during pregnancy has never been reported. Case Report. A 30-year-old woman with CD had improvement of her symptoms after transsphenoidal resection (TSA) of her pituitary lesion. She conceived unexpectedly 3 months postsurgery and had no symptoms or biochemical evidence of recurrence during pregnancy. After delivering a healthy boy, she developed CD 4 weeks postpartum and underwent a repeat TSA. Despite repeat TSA, she continued to have elevated cortisol levels that were not well controlled with medical management. She eventually had a bilateral adrenalectomy. Discussion. CD recurrence may be higher in the peripartum period, but the link between pregnancy and CD recurrence and/or persistence is not well studied. Potential mechanisms of CD recurrence in the postpartum period are discussed below. Conclusion. We describe the first report of recurrent CD that was quiescent during pregnancy and diagnosed in the immediate postpartum period. Understanding the risk and mechanisms of CD recurrence in pregnancy allows us to counsel these otherwise healthy, reproductive-age women in the context of additional family planning.

1. Introduction

Despite a relatively high prevalence of Cushing’s syndrome (CS) in women of reproductive age, it is rare for pregnancy to occur in patients with active disease [1]. Hypercortisolism leads to infertility through impairment of the hypothalamic gonadal axis. Additionally, while Cushing’s disease (CD) is the leading etiology of CS in nonpregnant adults, it is less common in pregnancy, accounting for only 30–40% of the CS cases in pregnant women [2]. It has been suggested that in CD there is hypersecretion of both cortisol and androgens, impairing fertility to a greater extent, while in CS of an adrenal origin, hypersecretion is almost exclusively of cortisol with minimal androgen production [3]. Regardless of the cause, active CS in pregnancy is associated with a higher maternal and fetal morbidity, hence, prompt diagnosis and treatment are essential.

Pregnancy is considered a physiological state of hypercortisolism, and the peripartum period is a common time for women to develop CD [34]. A recent study reported that 27% of reproductive-age women with CD had onset associated with pregnancy [4]. The high rate of pregnancy-associated CD suggests that the stress of pregnancy and peripartum pituitary corticotroph hyperstimulation may promote or accelerate pituitary tumorigenesis [46]. During pregnancy, the circulating levels of corticotropin-releasing hormone (CRH) in the plasma increase exponentially as a result of CRH production by the placenta, decidua, and fetal membranes rather than by the hypothalamus. Unbound circulating placental CRH stimulates pituitary ACTH secretion and causes maternal plasma ACTH levels to rise [4]. A review of the literature reveals many studies of CD onset during the peripartum period, but CD recurrence in the peripartum period has only been reported a handful of times [710]. Of these, most cases recurred during pregnancy. CD recurrence in the immediate postpartum period has only been reported once [7]. Below, we report for the first time a case of CD recurrence that occurred 4 weeks postpartum, with a documented dormant disease throughout pregnancy.

2. Case Presentation

A 30-year-old woman initially presented with prediabetes, weight gain, dorsal hump, abdominal striae, depression, lower extremity weakness, and oligomenorrhea with a recent miscarriage 10 months ago. Diagnostic tests were consistent with CD. Results included the following: three elevated midnight salivary cortisols: 0.33, 1.38, and 1.10 μg/dL (<0.010–0.090); 1 mg dexamethasone suppression test (DST) with cortisol 14 μg/dL (<1.8); elevated 24 hr urine cortisol (UFC) measuring 825 μg/24 hr (6–42); ACTH 35 pg/mL (7.2–63.3). MRI of the pituitary gland revealed a left 4 mm focal lesion (Figure 1(a)). After transsphenoidal resection (TSA), day 1, 2, and 3 morning cortisol values were 18, 5, and 2 μg/dL, respectively. Pathology did not show a definitive pituitary neoplasm. She was rapidly titrated off hydrocortisone (HC) by six weeks postresection. Her symptoms steadily improved, including improved energy levels, improved mood, and resolution of striae. She resumed normal menses and conceived unexpectedly around 3 months post-TSA. Hormonal evaluation completed a few weeks prior to her pregnancy indicated no recurrence: morning ACTH level, 27.8 pg/mL; UFC, 5 μg/24 hr; midnight salivary cortisol, 0.085 and 0.014 μg/dL. Her postop MRI at that time did not show a definitive adenoma (Figure 1(b)). During pregnancy, she had a normal oral glucose tolerance test at 20 weeks and no other sequela of CD. Every 8 weeks, she had 24-hour urine cortisol measurements. Of these, the highest was 93 μg/24 hr at 17 weeks and none were in the range of CD (Table 1). Towards the end of her 2nd trimester, she started to complain of severe fatigue. Given her low 24 hr urine cortisol level of 15 μg/24 hr at 36 weeks gestation, she was started on HC. She underwent a cesarean section at 40 weeks gestation for oligohydramnios and she subsequently delivered a healthy baby boy weighing 7.6 pounds with APGAR scores at 1 and 5 minutes being 9 and 9. HC was discontinued immediately after delivery. Around four weeks postpartum she developed symptoms suggestive for CD. Diagnostic tests showed an elevated midnight salivary cortisol of 0.206 and 0.723 μg/dL, and 24-hour urine cortisol of 400 μg/24 hr. MRI pituitary illustrated a 3 mm adenoma in the left posterior region of the gland, which was thought to represent a recurrent tumor (Figure 1(c)). A discrete lesion was found and resected during repeat TSA. Pathology confirmed corticotroph adenoma with MIB-1 < 3%. On postoperative days 1, 2, and 3, the cortisol levels were 26, 10, and 2.8 μg/dL, respectively. She was tapered off HC within one month. Her symptoms improved only slightly and she continued to report weight gain, muscle weakness, and fatigue. Three months after repeat TSA, biochemical data showed 1 out of 2 midnight salivary cortisols elevated at 0.124 μg/dL and elevated urine cortisol of 76 μg/24 hr. MRI pituitary demonstrated a 3 × 5 mm left enhancement, concerning for residual or enlarged persistent tumor. Subsequent lab work continued to show a biochemical excess of cortisol, and the patient was started on metyrapone but reported no significant improvement of her symptoms and only mild improvement of excess cortisol. After a multidisciplinary discussion, the patient made the decision to pursue bilateral adrenalectomy, as she refused further medical management and opted against radiation given the risk of hypogonadism.

(a)
(a)
(b)
(b)
(c)
(c)
(a)
(a)(b)
(b)(c)
(c)
Figure 1 
(a) Initial: MRI pituitary with and without contrast showing a coronal T1 postcontrast image immediately prior to our patient’s pituitary surgery. The red arrow points to a 3 × 3 × 5 mm hypoenhancing focus representing a pituitary microadenoma. (b) Postsurgical: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained three months after transsphenoidal pituitary surgery. The red arrow shows that a hypoenhancing focus is no longer seen and has been resected. (c) Postpartum: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained four weeks postpartum. The red arrow points to a 3 mm relatively hypoenhancing lesion representing a recurrent pituitary adenoma.
Table 1 
24-hour urine-free cortisol measurements collected approximately every 8 weeks throughout our patient’s pregnancy.

3. Discussion

The symptoms and signs of Cushing’s syndrome overlap with those seen in normal pregnancy, making diagnosis of Cushing’s disease during pregnancy challenging [1]. Potential mechanisms of gestational hypercortisolemia include increased systemic cortisol resistance during pregnancy, decreased sensitivity of plasma ACTH to negative feedback causing an altered pituitary ACTH setpoint, and noncircadian secretion of placental CRH during pregnancy causing stimulation of the maternal HPA axis [5]. Consequently, both urinary excretion of cortisol and late-night salivary cortisol undergo a gradual increase during normal pregnancy, beginning at the 11th week of gestation [2]. Cushing’s disease is suggested by 24-hour urinary-free cortisol levels greater than 3-fold of the upper limit of normal [2]. It has also been suggested that nocturnal salivary cortisol be used to diagnose Cushing’s disease by using the following specific trimester thresholds: first trimester, 0.25 μg/dL; second trimester, 0.26 μg/dL; third trimester 0.33, μg/dL [11]. By these criteria, our patient had no signs or biochemical evidence of CD during pregnancy but developed CD 4 weeks postpartum.

A recent study by Tang et al. proposed that there may be a higher risk of developing CD in the peripartum period, but did not test for CD during pregnancy, and therefore was not able to definitively say exactly when CD onset occurred in relation to pregnancy [4]. Previous literature suggests that there may be a higher risk of ACTH-secreting pituitary adenomas following pregnancy as there is a significant surge of ACTH and cortisol hormones at the time of labor. This increased stimulation of the pituitary corticotrophs in the immediate postpartum period may promote tumorigenesis [6]. It has also been suggested that the hormonal milieu during pregnancy may cause accelerated growth of otherwise dormant or small slow-growing pituitary corticotroph adenomas [45]. However, the underlying mechanisms of CD development in the postpartum period have yet to be clarified. We highlight the need for more research to investigate not only the development, but also the risk of CD recurrence in the postpartum period. Such research would be helpful for family planning.

4. Conclusion

Hypothalamic-pituitary-adrenal axis activation during pregnancy and the immediate postpartum period may result in higher rates of CD recurrence in the postpartum period, as seen in our patient. In general, more testing for CS in all reproductive-age females with symptoms suggesting CS, especially during and after childbirth, is necessary. Such testing can also help us determine when CD occurred in relation to pregnancy, so that we can further understand the link between pregnancy and CD occurrence, recurrence, and/or persistence. Learning about the potential mechanisms of CD development and recurrence in pregnancy will help us to counsel these reproductive-age women who desire pregnancy.

Abbreviations

CD: Cushing’s disease
TSA: Transsphenoidal resection
DST: Dexamethasone suppression test
ACTH: Adrenocorticotropic hormone
MRI: Magnetic-resonance imaging
HC: Hydrocortisone
CTH: Corticotroph-releasing hormone
HPA: Hypothalamic-pituitary-adrenal.

Data Availability

The data used to support the findings of this study are included within the article.

Additional Points

Note. Peripartum refers to the period immediately before, during, or after pregnancy and postpartum refers to any period after pregnancy up until 1 year postdelivery.

Disclosure

This case report is a follow up to an abstract that was presented in ENDO 2020 Abstracts. https://doi.org/10.1210/jendso/bvaa046.2128.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

The authors thank Dr. Puneet Pawha for his help in reviewing MRI images and his suggestions.

References

  1. J. R. Lindsay and L. K. Nieman, “The hypothalamic-pituitary-adrenal axis in pregnancy: challenges in disease detection and treatment,” Endocrine Reviews, vol. 26, no. 6, pp. 775–799, 2005.View at: Publisher Site | Google Scholar
  2. W. Huang, M. E. Molitch, and M. E. Molitch, “Pituitary tumors in pregnancy,” Endocrinology and Metabolism Clinics of North America, vol. 48, no. 3, pp. 569–581, 2019.View at: Publisher Site | Google Scholar
  3. M. C. Machado, M. C. B. V. Fragoso, M. D. Bronstein, and M. Delano, “Pregnancy in patients with cushing’s syndrome,” Endocrinology and Metabolism Clinics of North America, vol. 47, no. 2, pp. 441–449, 2018.View at: Publisher Site | Google Scholar
  4. K. Tang, L. Lu, M. Feng et al., “The incidence of pregnancy-associated Cushing’s disease and its relation to pregnancy: a retrospective study,” Frontiers in Endocrinology, vol. 11, p. 305, 2020.View at: Publisher Site | Google Scholar
  5. S. K. Palejwala, A. R. Conger, A. A. Eisenberg et al., “Pregnancy-associated Cushing’s disease? an exploratory retrospective study,” Pituitary, vol. 21, no. 6, pp. 584–592, 2018.View at: Publisher Site | Google Scholar
  6. G. Mastorakos and I. Ilias, “Maternal and fetal hypothalamic-pituitary-adrenal axes during pregnancy and postpartum,” Annals of the New York Academy of Sciences, vol. 997, no. 1, pp. 136–149, 2003.View at: Publisher Site | Google Scholar
  7. G. F. Yaylali, F. Akin, E. Yerlikaya, S. Topsakal, and D. Herek, “Cushing’s disease recurrence after pregnancy,” Endocrine Abstracts, vol. 32, 2013.View at: Publisher Site | Google Scholar
  8. C. V. L. Fellipe, R. Muniz, L. Stefanello, N. M. Massucati, and L. Warszawski, “Cushing’s disease recurrence during peripartum period: a case report,” Endocrine Abstracts, vol. 70, 2020.View at: Publisher Site | Google Scholar
  9. P. Recinos, M. Abbassy, V. Kshettry et al., “Surgical management of recurrent Cushing’s disease in pregnancy: a case report,” Surgical Neurology International, vol. 6, no. 26, pp. S640–S645, 2015.View at: Publisher Site | Google Scholar
  10. A. Nakhleh, L. Saiegh, M. Reut, M. S. Ahmad, I. W. Pearl, and C. Shechner, “Cabergoline treatment for recurrent Cushing’s disease during pregnancy,” Hormones, vol. 15, no. 3, pp. 453–458, 2016.View at: Publisher Site | Google Scholar
  11. L. M. L. Lopes, R. P. V. Francisco, M. A. K. Galletta, and M. D. Bronstein, “Determination of nighttime salivary cortisol during pregnancy: comparison with values in non-pregnancy and cushing’s disease,” Pituitary, vol. 19, no. 1, pp. 30–38, 2015.View at: Publisher Site | Google Scholar

Copyright © 2022 Leena Shah et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

From https://www.hindawi.com/journals/crie/2022/9236711/