Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Posted on July 23, 2024 by MaryO

Abstract

Objective

Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.

Methods

Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.

Results

In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.

Conclusion

Although the USP8–EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Peer Review reports

Introduction

Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [3, 4].

The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.

Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.

Methods

Case series

Study population

Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.

DNA extraction and Sanger sequencing

A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.

Systematic review

Overview of the systematic literature review

We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.

Search strategy

We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.

Inclusion and exclusion criteria

All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.

Results

Case series

Baseline characteristics of the participants

This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).

Frequency of USP8 gene variants

Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).

Fig. 1

figure 1

Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II

Clinical outcomes after surgery

All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).

Systematic review

The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.

Fig. 2
figure 2

Flow diagram of literature search and study selection

In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).

Table 1 Results of systematic literature review
Fig. 3

figure 3

Summary of USP8 mutations in patients with CD in selected studies

USP8 variants and the related pathways in corticotroph adenomas

In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].

Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].

Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].

A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].

DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].

Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma

Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].

In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].

A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].

USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma

Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].

In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].

A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].

Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].

Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].

The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].

Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].

Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].

Analytical conclusion

In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.

We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.

Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [6, 15]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.

Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.

Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [7, 24]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].

There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.

Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22, 25, 28, 30]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [24, 27, 42]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.

There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [30, 31]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [37, 38].

In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Data availability

The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.

Abbreviations

ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48

References

  1. Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.

  2. Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.

    Article CAS PubMed PubMed Central Google Scholar

  3. Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.

    Article CAS PubMed Google Scholar

  4. Mallari RJ, Thakur JD, Barkhoudarian G, Eisenberg A, Rodriguez A, Rettinger S, Cohan P, Nieman L, Kelly DF. Diagnostic pitfalls in Cushing Disease: Surgical Remission Rates, Test Thresholds, and lessons learned in 105 patients. J Clin Endocrinol Metab. 2022;107(1):205–18.

    Article PubMed Google Scholar

  5. Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.

    Article PubMed Google Scholar

  6. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.

    Article CAS PubMed Google Scholar

  7. Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.

    Article CAS PubMed PubMed Central Google Scholar

  8. Rebollar-Vega RG, Zuarth-Vázquez JM, Hernández-Ramírez LC. Clinical spectrum of USP8 pathogenic variants in Cushing’s Disease. Arch Med Res. 2023;54(8):102899.

    Article CAS PubMed Google Scholar

  9. Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.

    Article CAS PubMed PubMed Central Google Scholar

  10. Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.

    Article PubMed Google Scholar

  11. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.

    Article CAS PubMed PubMed Central Google Scholar

  12. Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.

  13. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.

    Article CAS PubMed Google Scholar

  14. Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.

    Article CAS PubMed Google Scholar

  15. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.

    Article CAS PubMed PubMed Central Google Scholar

  16. Martins CS, Camargo RC, Coeli-Lacchini FB, Saggioro FP, Moreira AC, de Castro M. USP8 mutations and cell cycle regulation in Corticotroph Adenomas. Horm Metab Res. 2020;52(2):117–23.

    Article CAS PubMed Google Scholar

  17. Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.

    Article CAS PubMed Google Scholar

  18. Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.

    Article CAS PubMed Google Scholar

  19. Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.

    Article PubMed PubMed Central Google Scholar

  20. Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.

    Article PubMed Google Scholar

  21. Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.

    Article PubMed Google Scholar

  22. Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.

    Article CAS PubMed PubMed Central Google Scholar

  23. Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.

    Article PubMed PubMed Central Google Scholar

  24. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.

  25. Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.

    Article CAS PubMed Google Scholar

  26. Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.

    Article CAS PubMed PubMed Central Google Scholar

  27. Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.

    Article CAS PubMed Google Scholar

  28. Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.

    Article CAS PubMed PubMed Central Google Scholar

  29. Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.

    Article CAS PubMed Google Scholar

  30. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.

    Article CAS PubMed Google Scholar

  31. Albani A, Perez-Rivas LG, Tang S, Simon J, Lucia KE, Colón-Bolea P, Schopohl J, Roeber S, Buchfelder M, Rotermund R, et al. Improved pasireotide response in USP8 mutant corticotroph tumours in vitro. Endocr Relat Cancer. 2022;29(8):503–11.

    Article CAS PubMed Google Scholar

  32. Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.

    Article CAS PubMed PubMed Central Google Scholar

  33. Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.

    Article CAS PubMed PubMed Central Google Scholar

  34. Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.

  35. Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.

    Article CAS PubMed Google Scholar

  36. Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.

    Article PubMed PubMed Central Google Scholar

  37. Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.

    Article CAS PubMed PubMed Central Google Scholar

  38. Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.

    Article CAS PubMed Google Scholar

  39. Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, Serban A, Ferrante E, Locatelli M, Lania AG, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. 2021;28(8):573–82.

    Article CAS PubMed Google Scholar

  40. Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.

    Article PubMed Google Scholar

  41. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.

    CAS PubMed Google Scholar

  42. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S. Transforming growth factor-alpha stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol. 2000;165(2):493–501.

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank all the participants enrolled in this study.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.

Author information

Author notes

  1. Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.

Authors and Affiliations

  1. Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran

    Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh

  2. Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran

    Ali Zare Mehrjardi

  3. Department of Endocrinology, Arad Hospital, Tehran, Iran

    Mahmoud Reza Kaynama

Contributions

Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad E. Khamseh.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Skip to figshare navigation

Below is the link to the electronic supplementary material.

Cite this article

Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord 24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z

Download citation

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable linkProvided by the Springer Nature SharedIt content-sharing initiative

Keywords

From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-024-01619-z

Filed under: Cushing's | Tagged: , , | Leave a comment »

Spontaneous Cushing’s Disease Remission Induced by Pituitary Apoplexy

Posted on July 17, 2024 by MaryO

Abstract

Spontaneous remission of Cushing’s disease (CD) is uncommon and often attributed to pituitary tumor apoplexy. We present a case involving a 14-year-old female who exhibited clinical features of Cushing’s syndrome. Initial diagnostic tests indicated CD: elevated 24h urinary cortisol (235 µg/24h, n < 90 µg/24h), abnormal 1 mg dexamethasone overnight test (cortisol after 1 mg dex 3.4 µg/dL, n < 1.8 µg/dL), and elevated adrenocorticotropic hormone concentrations (83.5 pg/mL, n 10-60 pg/mL). A pituitary adenoma was suspected, so a nuclear MRI was performed, with findings suggestive of a pituitary microadenoma. The patient was referred for a transsphenoidal resection of the microadenoma. While waiting for surgery, the patient presented to the emergency department with a headache and clinical signs of meningism. A computed axial tomography of the central nervous system was performed, and no structural alterations were found. The symptoms subsided with analgesia. One month later, she presented again to the emergency department with clinical findings of acute adrenal insufficiency (cortisol level of 4.06 µg/dL), and she was noted to have spontaneous biochemical remission associated with the resolution of her symptoms of hypercortisolism. For that reason, spontaneous CD remission induced by pituitary apoplexy (PA) was diagnosed. The patient has been managed conservatively since the diagnosis and remains in clinical and biochemical remission until the present time, after 10 months of follow-up. There are three unique aspects of our case: the early age of onset of symptoms, the spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that the patient presented a microadenoma because there are fewer than 10 clinical case reports of PA associated with microadenoma.

Introduction

Cushing’s disease (CD) is characterized by excessive production of adrenocorticotropic hormone by a pituitary adenoma and represents the most common cause of endogenous Cushing’s syndrome (CS) [1]. CD was first reported in 1912 by Harvey Williams Cushing, and he described 12 cases at the Peter Bent Brigham Hospital in Baltimore [2]. This disease has a global incidence of approximately 2.2 cases per 1,000,000 people and occurs more frequently in women from 20 to 50 years of age [3]. Pituitary apoplexy (PA) is a rare condition that occurs in 2-12% of cases, and it has a high morbidity and mortality rate [4]. We report an interesting case of a woman diagnosed with CD who achieved spontaneous remission of her disease after a PA.

Case Presentation

A 14-year-old female presented with a two-year history of weight gain (32 kg), depression, elevated blood pressure, type 2 diabetes mellitus, and growth failure (height less than the third percentile). Her height was 140 cm, and her BMI was 28.1 (97th percentile). At presentation, she had not yet reached menarche. Physical examination revealed Tanner 2 breast development, acne, hirsutism, moon facies, dorsocervical fat pad, central obesity, and stretch marks. Initial laboratory tests showed hemoglobin A1C of 13%, low-density lipoprotein of 167 mg/dL, triglycerides of 344 mg/dL, high-density lipoprotein of 26 mg/dL, creatinine of 0.4 mg/dL, and elevated liver enzymes. Abdominal ultrasound indicated moderate hepatic steatosis changes.

Given the high suspicion of CS, a hormonal profile was conducted (Table 1), confirming CS and subsequently diagnosing CD. A nuclear MRI revealed a 2.6 × 1.8 mm pituitary lesion (Figure 1), prompting referral for transsphenoidal resection of the pituitary microadenoma.

Laboratories Reference range Initial One month Three months Six months
TSH (mUI/L) 0.35-4.94 – 2.17 – 2.01
AM cortisol (µg/dL) 6.02-18.4 17.3 4.06 <0.5 4.7
1 mg DST (µg/dL) <1.8 3.4 – – –
8 mg DST (µg/dL) <50% suppression 1.9 (78% suppression) – – –
Urine-free cortisol (µg/24h) <90 235 – – –
ACTH (pg/mL) 10-60 83.5 – 19.2 9.7
IGF-1 (ng/mL) 36-300 – – – 293
Table 1: Pertinent laboratory investigation at baseline and follow-up with our patient

ACTH, adrenocorticotropic hormone; DST, dexamethasone suppression test; IGF-1, insulin growth factor-1; TSH, thyroid-stimulating hormone

Axial-view-of-a-T1-MRI-with-contrast-showing-a-sellar-lesion
Figure 1: Axial view of a T1 MRI with contrast showing a sellar lesion

The red arrow shows a microadenoma in relation to the normal pituitary gland.

Approximately one month after the suppression tests and while awaiting surgery, the patient presented to the emergency department with a sudden, severe, holocranial headache accompanied by projectile vomiting and diplopia, suggestive of meningism. A computed axial tomography of the central nervous system was conducted, revealing no structural abnormalities. Symptoms resolved with intravenous analgesia within approximately four to six hours. Subsequently, the patient experienced a significant decrease in insulin requirements, ultimately leading to the suspension of insulin therapy due to persistent hypoglycemia.

Weeks after the headache episode, the patient was reevaluated in the emergency department with a three-day history of diffuse abdominal pain, vomiting, asthenia, myalgia, hypotension, tachycardia, orthostatism, and recurrent hypoglycemia despite insulin suspension. Acute adrenal insufficiency was suspected and confirmed by a cortisol level of 4.06 µg/dL. Treatment with intravenous hydrocortisone 50 mg every six hours was initiated, leading to complete resolution of symptoms within 72 hours. The patient was discharged on maintenance therapy with oral hydrocortisone (20 mg in the morning and 10 mg at night). Subsequent follow-ups showed undetectable cortisol levels. Currently, the patient has been followed up for 10 months post-event, showing persistent clinical and hormonal remission of her disease.

Discussion

CD represents approximately 80% of cases of endogenous hypercortisolism, and pituitary microadenomas are the most common cause of CD in all age groups [5]. CD prevalence is 0.3-6.2 cases per 100,000 people [3], which represents 4.4% of all pituitary adenomas [6], and it is up to five times more likely to occur in women than men. Spontaneous remission of CD is rare, and it is mainly due to the apoplexy of a pituitary tumor [7].

PA is a potentially fatal condition resulting from hemorrhage or necrosis of a pituitary adenoma that produces compression of the surrounding structures with symptoms that can be critical and even fatal [8]. PA affects between 2% and 12% of patients with pituitary adenomas, mainly in nonfunctional macroadenomas [9]. Although the main mechanism of PA is hemorrhage, it can also be due to a hemorrhagic infarction or an infarction without hemorrhage; this last scenario is clinically less aggressive [10]. Among the most important precipitating factors are craniocerebral trauma, pregnancy, thrombocytopenia, coagulopathies, pituitary stimulation tests, drugs such as anticoagulants and estrogens, surgeries that are complicated by hypotension, and radiotherapy [4,11,12].

There are three unique aspects of our case. First, the age of onset is 14 years old. This characteristic has been reported in less than 6% of cases of CD, with a mean age of onset between 12.3 and 14.1 years and a slightly higher incidence in men (63%) [13]. In this population, CD is the most common cause of hypercortisolism, accounting for 75-80% of all cases [14]. Furthermore, our patient presented a significant weight gain, severe compromise in her height, hypertension, depression, and diabetes mellitus, which is compatible with the classic profile described for CD in pediatric ages. It is important to clarify that although type 2 diabetes mellitus is common in adults, it is unusual in the pediatric population [13].

Second, spontaneous remission in CD due to apoplexy has been rarely reported in the past; hence, our case is an important addition to the scant literature on this unusual phenomenon. Although there are characteristics suggestive of PA, such as hyperdense lesions within the pituitary gland and the reinforcing ring, a CT scan has a low sensitivity for detecting pituitary hemorrhage (21-46%); therefore, a negative CT scan does not rule out PA in cases where there is infarction without hemorrhage, a situation that could correspond to our case [15].

The third unique feature of our case is that the stroke occurred in the context of a microadenoma, a situation reported in less than 10 cases in the literature. Despite being a microadenoma, the symptoms of PA were severe, with symptoms of meningism, an intense headache, vomiting, and the development of adrenal insufficiency. Taylor et al. [16] reported a similar case of a 41-year-old female with microadenoma whose PA was associated with severe headache and vomiting.

The main differential diagnosis in our case is cyclical CS (CCS), a disorder that occurs in 15% of CS cases, especially in CD [17]. The diagnosis of CCS is classically established with three peaks and two valleys in cortisol secretion, spontaneous fluctuations, and clinical features of CS [7]. The possibility of CCS was ruled out due to the typical presentation of the PA event and the persistence of hypocortisolism.

Finally, several cases of recurrence of their disease have been described after remission of CS due to AP. Those recurrences usually develop in follow-ups of up to seven years [18]. At the time of the last evaluation (10 months post-PA), the patient remained in remission, but long-term follow-up is required to detect both reactivation and hypopituitarism [19].

Conclusions

CD is a rare entity in the pediatric population, usually associated with a pituitary microadenoma. Spontaneous remission of this disease is very uncommon, but when it occurs, it is mainly due to PA. We describe a case with three unique aspects: CD with an early age of onset of symptoms, spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that there are less than 10 clinical case reports of PA associated with microadenoma. It is imperative for clinicians to be aware of this possible outcome in patients with CD.

References

  1. Fleseriu M, Auchus R, Bancos I, et al.: Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol. 2021, 9:847-75. 10.1016/S2213-8587(21)00235-7
  2. Bray DP, Rindler RS, Dawoud RA, Boucher AB, Oyesiku NM: Cushing disease: medical and surgical considerations. Otolaryngol Clin North Am. 2022, 55:315-29. 10.1016/j.otc.2021.12.006
  3. Giuffrida G, Crisafulli S, Ferraù F, et al.: Global Cushing’s disease epidemiology: a systematic review and meta-analysis of observational studies. J Endocrinol Invest. 2022, 45:1235-46. 10.1007/s40618-022-01754-1
  4. Briet C, Salenave S, Bonneville JF, Laws ER, Chanson P: Pituitary apoplexy. Endocr Rev. 2015, 36:622-45. 10.1210/er.2015-1042
  5. Newell-Price J, Bertagna X, Grossman A, Nieman L: Cushing’s syndrome. Lancet. 2006, 367:1605-17. 10.1016/S0140-6736(06)68699-6
  6. Daly AF, Beckers A: The epidemiology of pituitary adenomas. Endocrinol Metab Clin North Am. 2020, 49:347-55. 10.1016/j.ecl.2020.04.002
  7. Popa Ilie IR, Herdean AM, Herdean AI, Georgescu CE: Spontaneous remission of Cushing’s disease: a systematic review. Ann Endocrinol (Paris). 2021, 82:613-21. 10.1016/j.ando.2021.10.002
  8. Siwakoti K, Omay SB, Inzucchi SE: Spontaneous resolution of primary hypercortisolism of Cushing disease after pituitary hemorrhage. AACE Clin Case Rep. 2020, 6:e23-9. 10.4158/ACCR-2019-0292
  9. Dubuisson AS, Beckers A, Stevenaert A: Classical pituitary tumour apoplexy: clinical features, management and outcomes in a series of 24 patients. Clin Neurol Neurosurg. 2007, 109:63-70. 10.1016/j.clineuro.2006.01.006
  10. Semple PL, De Villiers JC, Bowen RM, Lopes MB, Laws ER Jr: Pituitary apoplexy: do histological features influence the clinical presentation and outcome?. J Neurosurg. 2006, 104:931-7. 10.3171/jns.2006.104.6.931
  11. Turgut M, Ozsunar Y, Başak S, Güney E, Kir E, Meteoğlu I: Pituitary apoplexy: an overview of 186 cases published during the last century. Acta Neurochir (Wien). 2010, 152:749-61. 10.1007/s00701-009-0595-8
  12. Wildemberg LE, Glezer A, Bronstein MD, Gadelha MR: Apoplexy in nonfunctioning pituitary adenomas. Pituitary. 2018, 21:138-44. 10.1007/s11102-018-0870-x
  13. Concepción-Zavaleta MJ, Armas CD, Quiroz-Aldave JE, et al.: Cushing disease in pediatrics: an update. Ann Pediatr Endocrinol Metab. 2023, 28:87-97. 10.6065/apem.2346074.037
  14. Ferrigno R, Hasenmajer V, Caiulo S, et al.: Paediatric Cushing’s disease: epidemiology, pathogenesis, clinical management and outcome. Rev Endocr Metab Disord. 2021, 22:817-35. 10.1007/s11154-021-09626-4
  15. Banerjee AK: Diagnostic imaging: Brain. 2nd edition. Br J Radiol. 2010, 83:450-1.
  16. Taylor HC, McLean S, Monheim K: Resolution of Cushing’s disease followed by secondary adrenal insufficiency after anticoagulant-associated pituitary hemorrhage: report of a case and review of the literature. Endocr Pract. 2003, 9:147-51. 10.4158/EP.9.2.147
  17. Alexandraki KI, Kaltsas GA, Isidori AM, et al.: The prevalence and characteristic features of cyclicity and variability in Cushing’s disease. Eur J Endocrinol. 2009, 160:1011-8. 10.1530/EJE-09-0046
  18. Kamiya Y, Jin-No Y, Tomita K, et al.: Recurrence of Cushing’s disease after long-term remission due to pituitary apoplexy. Endocr J. 2000, 47:793-7. 10.1507/endocrj.47.793
  19. Machado MC, Gadelha PS, Bronstein MD, Fragoso MC: Spontaneous remission of hypercortisolism presumed due to asymptomatic tumor apoplexy in ACTH-producing pituitary macroadenoma. Arq Bras Endocrinol Metabol. 2013, 57:486-9. 10.1590/s0004-27302013000600012

Filed under: Cushing's, pituitary | Tagged: , , , , , , | Leave a comment »

Repeat Endoscopic Endonasal Transsphenoidal Surgery for Residual or Recurrent Cushing’s Disease: Safety, Feasibility, And Success

Posted on May 27, 2024 by MaryO

Abstract

Purpose

The success and outcomes of repeat endoscopic transsphenoidal surgery (ETS) for residual or recurrent Cushing’s disease (CD) are underreported in the literature. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in these patients.

Methods

A retrospective analysis was conducted on 56 patients who underwent a total of 65 repeat ETS performed by a single neurosurgeon between January 2006 and December 2020. Data including demographic, clinical, laboratory, radiological, and operative details were collected from electronic medical records. Logistic regression was utilized to identify potential predictors associated with sustained remission.

Results

Among the cases, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had prior endoscopic procedures. Remission was achieved in 47 (83.9%) patients after the first repeat ETS, with an additional 9 (16.1%) achieving remission after the second repeat procedure. During an average follow-up period of 97.25 months, the recurrence rate post repeat surgery was 6.38%. Sustained remission was achieved in 48 patients (85.7%), with 44 after the first repeat ETS and 4 following the second repeat ETS. Complications included transient diabetes insipidus (DI) in 5 (7.6%) patients, permanent (DI) in 2 (3%) patients, and one case (1.5%) of panhypopituitarism. Three patients (4.6%) experienced rhinorrhea necessitating reoperation. A serum cortisol level > 5 µg/dL on postoperative day 1 was associated with a reduced likelihood of sustained remission.

Conclusion

Repeat ETS is a safe and effective treatment option for residual or recurrent CD with satisfactory remission rates and low rates of complications.

Similar content being viewed by others

Introduction

Cushing’s disease (CD) arises from an adrenocorticotropic hormone (ACTH)-secreting pituitary adenoma, leading to excessive endogenous glucocorticoid production [1]. The reported incidence of CD varies from 0.7 to 2.4 cases per million individuals annually [2,3,4,5,6]. Hypercortisolism impacts every bodily system and is linked to elevated morbidity and mortality risks [7, 8]. Therefore, prompt CD diagnosis and management are crucial to enhance patient outcomes.

Transsphenoidal surgery remains the primary treatment for CD, and have been associated with satisfactory remission rates ranging from 65 to 94% [2, 3, 5, 9,10,11]. Two surgical techniques are utilized: microscopic and endoscopic approaches. While both methods are effective, studies indicate that endoscopic transsphenoidal surgery (ETS) offers higher rates of complete tumor removal and lower complication rates [12,13,14]. ETS holds advantages over microscopic transsphenoidal surgery (MTS) due to superior tumor visualization, especially for laterally invasive tumors and macroadenomas [15]. Since its introduction in 1997, ETS has gained popularity and is now the standard surgical approach for managing CD [16].

Remission rates post-ETS for CD treatment range from 77 to 90% [17,18,19,20,21,22]. Despite ETS’s technical benefits and favorable outcomes, recurrence rates for Cushing’s disease after successful ETS range between 5.6% and 22.8% [17, 18, 22, 23]. Reoperating for residual or recurrent CD presents challenges due to altered surgical landmarks and scar tissue formation from previous surgeries, potentially elevating morbidity, and mortality risks [24, 25]. Limited literature exists on the success and outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent CD. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in patients with residual or recurrent Cushing’s disease.

Methods

Study design

This is a retrospective cohort study of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease. All patients underwent endoscopic endonasal transsphenoidal surgery by the senior author between 2006 and 2020. The study protocol was approved by the local ethics committee for clinical studies.

Patient selection

The study participants were selected based on specific inclusion and exclusion criteria. Inclusion criteria were as follows: (i) a confirmed diagnosis of Cushing’s disease, (ii) prior transsphenoidal surgery, and (iii) confirmation of residual or recurrent CD through clinical, laboratory, and/or imaging assessments. Exclusion criteria included: (i) prior craniotomy without transsphenoidal surgery, (ii) previous radiotherapy before reoperation, (iii) inaccessible clinical, laboratory, or radiological data, and (iv) follow-up duration of less than 6 months.

Diagnostic criteria

Each patient underwent thorough screening for active Cushing’s disease. An increased 24-hour urine cortisol level > 45 µg/day or a serum fasting cortisol level exceeding 1.8 µg/dl following a low-dose (2 mg) dexamethasone suppression test was deemed abnormal. Subsequently, a high-dose (8 mg) dexamethasone test was administered, and a reduction of 50% or more from the baseline value was indicative of active Cushing’s disease. Due to the technical limitations of the institution that the research has been done, late-night salivary cortisol tests were not performed. Early remission was characterized by a fasting serum cortisol level below 5 µg/dl on the 1st and 7th postoperative days. Patients displaying a serum cortisol level below 1.8 µg/dl after the low-dose dexamethasone suppression test or those requiring continued corticosteroid replacement post-surgery were considered to maintain remission. The presence of a residual adenoma on postoperative magnetic resonance imaging (MRI) confirmed residual disease.

Routine follow-up protocol

Patients were evaluated for Cushing’s disease symptoms before surgery and monitored at 6 months after surgery, as well as during yearly check-ups for any changes in their condition. Fasting serum ACTH and cortisol levels were measured in the morning before surgery, on the 1st and 7th days after surgery, at the 1st, 3rd, and 6th months, and during yearly follow-up appointments. Prior to surgery, all patients underwent contrast-enhanced pituitary MRI and paranasal sinus CT scans. Follow-up pituitary MRI scans were conducted on the 1st day, at 3 and 12 months after surgery, and then annually thereafter.

Data collection

Data from electronic medical records were gathered, encompassing demographic, clinical, laboratory, radiological, and operative details. Laboratory assessments comprised an anterior pituitary hormone panel (Follicle-stimulating hormone [FSH], Luteinizing hormone [LH], Thyroid-stimulating hormone [TSH], Prolactin [PRL], Growth hormone [GH]), serum electrolytes, preoperative and postoperative serum ACTH, and cortisol levels. Patient records, along with CT and MRI scans, were scrutinized to document preoperative tumor characteristics such as size, multifocality, relationship with the cavernous sinus, Hardy-Wilson classification of sellar destruction, and suprasellar extension. Tumors larger than 10 mm were classified as macroadenomas. The operative database was examined to collect data on previous surgeries, including the number and dates of prior procedures, as well as the surgical techniques utilized. Outcome measures comprised remission rates and surgical complications.

Statistical analysis

Statistical analysis was conducted utilizing SPSS 23.0 software (IBM, New York). Two-group comparisons were performed using Chi-square and Fisher’s exact tests for categorical variables and Student’s t-test for continuous variables. Categorical variables were presented as numbers and percentages, while continuous variables were presented as means ± SD or median [IQR]. Logistic regression was performed to investigate potential predictors linked to sustained remission. A p-value of < 0.05 was deemed statistically significant.

Results

Baseline characteristics

Supplementary File 1 displays the demographic characteristics of the patient cohort.

A retrospective analysis was conducted on 190 patients who underwent a total of 212 operations for CD at our department between January 2006 and December 2020. Among them, 56 patients, comprising 65 repeat endonasal transsphenoidal surgeries due to either recurrence (n = 18, 27.7%) or residual disease (n = 47, 72.3%), were identified. The majority of patients were female (n = 48, 85.7%), with a mean age of 37.6 ± 12.4 years. Of the 56 patients, 43 (76.8%) were referred from another institution. Most patients (n = 42, 75%) had undergone only one prior surgery, while 12 patients (21.4%) had a history of two previous surgeries, and 2 patients (3.6%) had undergone three prior surgeries before referral to our center. The average follow-up duration since the first repeat ETS was 97.2 ± 36.8 months. The mean time to recurrence was 80.2 ± 61.1 months (median 75 months, range 23.2 to 103.5 months).

Hormonal data

Table 1 depicts the preoperative and postoperative serum ACTH and cortisol levels. The average preoperative serum cortisol levels for the entire patient cohort stood at 18.7 ± 11.1 µg/dL (median 17, range 12-24.6). The median preoperative 24-hour urine free cortisol level was 237 µg /day [188.5–425.5]. On the initial postoperative day, the mean serum cortisol levels for all patients were 13.4 ± 13.8 µg/dL (median 6.4, range 1.7–21). In 46.2% of cases (n = 30), cortisol levels on the first postoperative day were below 5 µg/dL (< 2 µg/dL in 33.8%). A comparison of the mean preoperative and postoperative serum ACTH and cortisol levels between the groups with residual disease and recurrence is detailed in Table 1.

Table 1 Cohort overview and comparison of recurrence and residual disease groups

Radiological findings

In the entire case cohort, there were 41 microadenomas (63.1%) and 24 macroadenomas (36.9%). Fifteen cases (23.1%) exhibited bifocal adenomas. Adenoma extension into the cavernous sinuses, indicated by cavernous sinus wall displacement, was present in 21 cases (32.3%), while invasion into the cavernous sinuses was observed in 10 cases (15.4%). Based on the Hardy-Wilson Classification, there were 38 Grade I adenomas (58.5%), 16 Grade II adenomas (24.6%), 6 Grade III adenomas (9.2%), and 5 Grade IV adenomas (7.7%). Thirty patients (46.2%) presented with Stage A adenoma, 7 (10.8%) with Stage B adenoma, 2 (3.1%) with Stage C adenoma, 1 (1.5%) with Stage D adenoma, and 25 (38.5%) with Stage E adenoma. As indicated in Table 1, there were no statistically significant differences between patients with residual disease and recurrence concerning radiological findings.

Surgical characteristics

A single surgeon conducted all 65 reoperations. Among these, 47 patients (72.3%) underwent repeat ETS due to residual disease, while 18 (27.7%) did so due to recurrence. The previous surgical technique was microscopic in 40 cases (61.5%) and endoscopic in 25 cases (38.5%). Microscopic transsphenoidal surgeries were exclusively performed at other institutions. There was a notable disparity between patients with residual disease and recurrence regarding the technique of the previous surgery. Residual disease occurrence following endoscopic transsphenoidal surgery was less frequent (n = 11/25, 44%) compared to after microscopic transsphenoidal surgery (n = 36/40, 90%; p < 0.001) (Table 1). Immunohistochemical staining of the specimens indicated that 55 cases (85%) exhibited ACTH-positive adenoma. Nevertheless, all patients with a negative pathology at the repeat surgery had a confirmed ACTH-adenoma at the first surgery. Of the 10 patients (15%) with a negative ACTH-positive adenoma pathology, two patients underwent inferior petrosal sinus sampling (IPSS) previously and were confirmed to have CD. Remaining patients did not undergo an additional inferior petrosal sinus sampling (IPSS) because all functional test results indicated a central source and MRI confirmed pituitary microadenoma in all cases. Notably, there are studies reporting that IPSS may not be required in patients with a sellar mass and a biochemical testing suggestive of CD [26, 27]. Additionally, we also explored both sides of the pituitary and confirmed the adenoma intraoperatively. Therefore, negative pathology in the repeat surgery is most likely due to sampling error.

Outcomes

As depicted in Fig. 1, among the 56 patients, 47 (83.9%) experienced initial remission following the first repeat ETS, while 9 (16.1%) still had residual adenoma. Within the group achieving initial remission, 44 patients (93.6%) maintained remission without the need for further surgeries, while 3 (6.4%) experienced recurrence during follow-up and required a second repeat ETS.

Fig. 1
figure 1

Outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease

Among the 9 patients with residual disease after the first repeat ETS, 1 (11.1%) opted to defer further treatment, 1 (11.1%) received radiotherapy, 1 (11.1%) chose adrenalectomy, and 6 (66.7%) underwent a second repeat ETS. Of the 9 patients who underwent a second repeat ETS due to residual disease or recurrence, 4 (44.4%) sustained remission, 5 (55.6%) still had residual disease, but 3 of them deferred further treatment, 1 received radiotherapy, while 1 achieved remission after adrenalectomy. Overall, 78.5% (n = 51) of the entire case cohort achieved remission following repeat ETS. Representative cases are presented in Fig. 2.

Fig. 2
figure 2

Case 1: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 49-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 14 years ago at an outside institution. Preoperative T2 (A), and T1 contrast-enhanced (B) MRI scans demonstrate a right-sided pituitary adenoma. Postoperative T2 (C), and T1 contrast-enhanced (D) MRI scans demonstrate total resection of the adenoma. Case 2: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 53-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 3 years ago at an outside institution. Preoperative T2 (E), and T1 contrast-enhanced (F) MRI scans demonstrate a left-sided pituitary adenoma, in close relation to ICA. Postoperative T2 (G), and T1 contrast-enhanced (H) MRI scans demonstrate total resection of the adenoma

Transient diabetes insipidus (DI) developed in 5 patients (7.6%), while 2 (3%) experienced permanent DI following repeat ETS. Intraoperative cerebrospinal fluid (CSF) leak occurred in 20 operations (30.7%). Three patients (4.6%) developed rhinorrhea and required reoperation. Five patients (7.6%) developed prolactin deficiency, 3 patients (4.6%) had GH deficiency, and another 3 patients (4.6%) had TSH deficiency requiring thyroxine replacement. Four patients (6.2%) had combined deficiencies in TSH, FSH, LH and prolactin, while one patient (1.5%) developed panhypopituitarism following the second repeat ETS.

Factors predisposing to unsuccessful repeat endoscopic transsphenoidal surgery

Among the 42 patients who underwent repeat ETS for residual disease, 9 (21.4%) still had residual disease after the first repeat ETS. We conducted a multivariable logistic regression analysis to explore potential risk factors for unsuccessful repeat ETS. However, the analysis did not reveal any significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size (Supplementary File 1).

Potential predictors of sustained remission

We conducted a multivariable logistic regression analysis to investigate possible predictors of sustained remission. The variables included in the analysis are detailed in Table 5. The results indicated that having a serum cortisol level exceeding 5 µg/dL on postoperative day 1 was linked to a decreased likelihood of achieving sustained remission (Odds ratio [OR] 0.09, 95% confidence interval [CI] 0.01–0.52, p = 0.006) (Table 2).

Table 2 Logistic regression analysis of potential predictors for continued remission

Discussion

Transsphenoidal surgery remains the established standard for treating Cushing’s disease, with demonstrated remission rates ranging from 65 to 94%, contingent upon the surgeon’s expertise and remission criteria [2, 3, 5, 9,10,11]. The advent of endoscopic techniques has notably augmented this approach, offering wider visibility, reduced nasal trauma, and shorter hospital stays [16, 25, 28, 29]. While the effectiveness of ETS in managing CD is well-documented, literature on its efficacy in treating residual or recurrent cases is limited. Our study addresses this gap by assessing the safety, feasibility, and outcomes of repeat ETS for patients with persistent or recurrent Cushing’s disease.

In our study, 56 patients underwent 65 repeat ETS procedures for residual or recurrent Cushing’s disease. Mean follow-up duration was 97.2 ± 36.8 months, which is one of the longest follow-up durations that has been reported following repeat endoscopic transsphenoidal surgery [5, 30,31,32]. Of these patients, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had undergone prior endoscopic procedures. Importantly, a notable difference emerged between patients with residual disease and those experiencing recurrence regarding the prior surgical approach, with residual disease being less frequent after endoscopic surgery compared to microscopic surgery (p < 0.001). This variance was expected, as numerous studies have indicated that ETS yields a higher rate of complete resection compared to MTS [12,13,14].

After the first repeat ETS, 47 patients (83.9%) achieved remission, and 78.5% (n = 44) of them maintained remission at a mean follow-up of 97.2 months without requiring additional surgery. Limited data exists regarding the remission rates of CD following repeat transsphenoidal surgery, with reported rates ranging from 28.9 to 73% [33, 34, 35]. Burke et al. reported an immediate remission rate of 86.7% and a continued remission rate of 73.3% at follow-up after repeat ETS [36]. Among our patients who achieved remission after successful repeat ETS, 3 individuals (6.38%, n = 3/47) experienced recurrence after the first repeat ETS, with a mean time to recurrence of 45.6 months. The rates of CD recurrence following reoperation vary, with documented rates ranging between 22% and 63.2% [37, 38]. In our study, 9 patients required a second repeat ETS due to residual disease or recurrence. Of these, 4 (44.4%) achieved continued remission following the second repeat ETS, while 5 (55.6%) had residual disease; however, 4 of them deferred further treatment, and 1 achieved remission after adrenalectomy. In total, 47 patients (83.9%) in the entire patient cohort achieved remission following endoscopic transsphenoidal surgery and did not require further intervention.

Within our case cohort, among the 42 patients who underwent repeat ETS for residual disease, 9 individuals (21.4%) continued to exhibit residual disease following the first repeat ETS. We did not establish a significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size.

The degree of hypocortisolism following transsphenoidal surgery is considered a potential indicator of remission in the postoperative period [3]. Numerous studies have indicated that patients with subnormal postoperative cortisol levels tend to experience a lower recurrence rate compared to those with normal or supranormal levels, although consensus on the precise cutoff level remains elusive [30,31,32, 39]. In a retrospective study involving 52 patients with CD, researchers reported a 100% positive predictive value of a postoperative nadir cortisol level < 2 µg/dL for achieving remission [5]. Additionally, Esposito et al. observed that a morning serum cortisol level ≤ 5 µg/dL on postoperative day 1 or 2 appears to serve as a reliable predictor of remission [11]. In our investigation, logistic regression analysis revealed that patients with a serum cortisol level > 5 µg/dL on postoperative day 1 were less inclined to achieve continued remission compared to those with a serum cortisol level < 5 µg/dL on postoperative day 1.

Repeat transsphenoidal surgery presents unique challenges due to distorted surgical landmarks and the presence of scar tissue from prior procedures, often resulting in lower cure rates and increased morbidity risk [24, 25, 28]. Non-surgical options such as radiotherapy and radiosurgery have been considered as an effective treatment option for recurrent or residual CD due to low rates of morbidity and acceptable remission rates [28, 40]. However, our findings suggest that the outcomes and complication rates associated with repeat ETS are comparable to primary ETS for CD and superior to other non-surgical options for residual or recurrent CD. Within our patient cohort, 5 (7.6%) individuals experienced transient diabetes insipidus (DI), while 2 (3%) developed permanent DI. Additionally, one patient (1.5%) experienced panhypopituitarism following the second repeat ETS. Similarly, various studies have reported DI rates ranging from 2 to 13% and panhypopituitarism rates between 2% and 9.7% [25, 28, 41,42,43]. In our series, 3 (5.3%) patients developed rhinorrhea and required reoperation, consistent with reported rates of postoperative CSF leak ranging from 1 to 5% following repeat endoscopic transsphenoidal surgery for residual or recurrent pituitary tumors [25, 28, 44]. While radiotherapy and radiosurgery are options for patients who have failed transsphenoidal surgery or experienced recurrence, the literature suggests remission rates ranging from 46 to 84%, with several studies indicating high recurrence rates (25-50%) following radiotherapy [40, 45,46,47]. In our study, among 56 patients, 47 (83.9%) achieved remission following the first repeat ETS, while 4 (17.8%) achieved remission after the second repeat ETS. Over a mean follow-up duration of 97.25 months, our recurrence rate following repeat ETS was 27.7%, with a mean time to recurrence of 45.62 months.

At our institution, we adhere to a specific algorithm (Fig. 3) for managing Cushing’s disease patients and implement a meticulous protocol for individuals undergoing repeat ETS for residual or recurrent CD. A thorough clinical and radiological assessment is conducted for all patients before surgery. Detailed radiological evaluation is particularly essential to identify any distortions in surgical landmarks from prior procedures, such as the course of sphenoidal septa and the location of the sellar floor opening, as well as other potential aberrations like internal carotid artery and optic nerve dehiscence. Imaging techniques should encompass dynamic pituitary MRI with and without contrast and paranasal CT scans. Our objective is to achieve extensive exposure during surgery, which is especially critical for managing bifocal adenomas or adenomas with cavernous sinus invasion or extension. The expanded visual field also facilitates the visualization of concealed parts of the adenoma, allowing the surgeon to achieve complete resection, which may be challenging or even impossible with limited exposure. We employ a multilayer closure technique to prevent CSF leaks, and if necessary, utilize a vascularized pedicled nasoseptal flap (Hadad-Bassagasteguy flap).

Fig. 3
figure 3

Specific algorithm for the management of Cushing’s disease patients

In summary, our findings suggest that in the hands of experienced surgeons, repeat ETS represents a safe and effective treatment option for managing residual or recurrent Cushing’s disease.

Strengths and limitations

Our study represents one of the largest case series in the literature examining the safety, feasibility, and efficacy of repeat ETS for managing recurrent or residual CD. Our findings underscore the safety and efficacy of repeat ETS in experienced centers, showcasing satisfactory remission rates and minimal complications. However, it is important to acknowledge the retrospective nature of our study, which inherently introduces potential biases such as selection bias. Lastly, our study exclusively focuses on patients undergoing surgical intervention for recurrent or residual CD, limiting our ability to compare the effectiveness of surgical treatment with alternative modalities like radiotherapy or radiosurgery.

Conclusion

Our study underscores the efficacy and safety of repeat endoscopic transsphenoidal surgery in managing residual or recurrent Cushing’s disease. Remarkably, 82.1% of patients achieved remission after their first reoperation, aligning closely with reported remission rates following primary endoscopic transsphenoidal surgery. Furthermore, the complication rates observed in our cohort were consistent with documented rates for both primary and repeat transsphenoidal surgeries. Notably, patients with serum cortisol levels < 5 µg/dL are more likely to maintain remission. Overall, our findings emphasize that in the hands of experienced surgeons, repeat endoscopic transsphenoidal surgery emerges as a reliable and safe treatment modality for residual or recurrent Cushing’s disease, offering satisfactory remission rates and minimal complications.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

ACTH:
adrenocorticotropic hormone
CD:
Cushing’s disease
CT:
computed tomography
DI:
diabetes insipidus
ETS:
endoscopic endonasal transsphenoidal surgery
MRI:
magnetic resonance imaging
MTS:
microscopic transsphenoidal surgery

References

  1. Cushing H (1994) The basophil adenomas of the pituitary body and their clinical manifestations (pituitary basophilism). 1932. Obes Res 2(5):486–508

    Article CAS PubMed Google Scholar

  2. Aranda G, Enseñat J, Mora M, Puig-Domingo M, Martínez de Osaba MJ, Casals G et al (2015) Long-term remission and recurrence rate in a cohort of Cushing’s disease: the need for long-term follow-up. Pituitary 18(1):142–149

    Article CAS PubMed Google Scholar

  3. Pendharkar AV, Sussman ES, Ho AL, Hayden Gephart MG, Katznelson L (2015) Cushing’s disease: predicting long-term remission after surgical treatment. Neurosurg Focus 38(2):E13

    Article PubMed Google Scholar

  4. Etxabe J, Vazquez JA (1994) Morbidity and mortality in Cushing’s disease: an epidemiological approach. Clin Endocrinol (Oxf) 40(4):479–484

    Article CAS PubMed Google Scholar

  5. Hameed N, Yedinak CG, Brzana J, Gultekin SH, Coppa ND, Dogan A et al (2013) Remission rate after transsphenoidal surgery in patients with pathologically confirmed Cushing’s disease, the role of cortisol, ACTH assessment and immediate reoperation: a large single center experience. Pituitary 16(4):452–458

    Article CAS PubMed Google Scholar

  6. Acebes JJ, Martino J, Masuet C, Montanya E, Soler J (2007) Early post-operative ACTH and cortisol as predictors of remission in Cushing’s disease. Acta Neurochir (Wien). ;149(5):471-7; discussion 7–9

  7. Fernandez-Rodriguez E, Stewart PM, Cooper MS (2009) The pituitary-adrenal axis and body composition. Pituitary 12(2):105–115

    Article CAS PubMed Google Scholar

  8. van Haalen FM, Broersen LH, Jorgensen JO, Pereira AM, Dekkers OM (2015) Management of endocrine disease: mortality remains increased in Cushing’s disease despite biochemical remission: a systematic review and meta-analysis. Eur J Endocrinol 172(4):R143–R149

    Article PubMed Google Scholar

  9. Locatelli M, Vance ML, Laws ER (2005) Clinical review: the strategy of immediate reoperation for transsphenoidal surgery for Cushing’s disease. J Clin Endocrinol Metab 90(9):5478–5482

    Article CAS PubMed Google Scholar

  10. Blevins LS Jr., Christy JH, Khajavi M, Tindall GT (1998) Outcomes of therapy for Cushing’s disease due to adrenocorticotropin-secreting pituitary macroadenomas. J Clin Endocrinol Metab 83(1):63–67

    CAS PubMed Google Scholar

  11. Esposito F, Dusick JR, Cohan P, Moftakhar P, McArthur D, Wang C et al (2006) Clinical review: early morning cortisol levels as a predictor of remission after transsphenoidal surgery for Cushing’s disease. J Clin Endocrinol Metab 91(1):7–13

    Article CAS PubMed Google Scholar

  12. Guo S, Wang Z, Kang X, Xin W, Li X (2021) A Meta-analysis of endoscopic vs. microscopic transsphenoidal surgery for non-functioning and functioning pituitary adenomas: comparisons of efficacy and safety. Front Neurol. ;12

  13. Gao Y, Zhong C, Wang Y, Xu S, Guo Y, Dai C et al (2014) Endoscopic versus microscopic transsphenoidal pituitary adenoma surgery: a meta-analysis. World J Surg Oncol 12:94

    Article PubMed PubMed Central Google Scholar

  14. Yu SY, Du Q, Yao SY, Zhang KN, Wang J, Zhu Z, Jiang XB (2018) Outcomes of endoscopic and microscopic transsphenoidal surgery on non-functioning pituitary adenomas: a systematic review and meta-analysis. J Cell Mol Med 22(3):2023–2027

    Article PubMed PubMed Central Google Scholar

  15. Broersen LHA, van Haalen FM, Biermasz NR, Lobatto DJ, Verstegen MJT, van Furth WR et al (2019) Microscopic versus endoscopic transsphenoidal surgery in the Leiden cohort treated for Cushing’s disease: surgical outcome, mortality, and complications. Orphanet J Rare Dis 14(1):64

    Article PubMed PubMed Central Google Scholar

  16. Jho HD, Carrau RL (1997) Endoscopic endonasal transsphenoidal surgery: experience with 50 patients. J Neurosurg 87(1):44–51

    Article CAS PubMed Google Scholar

  17. Berker M, Işikay I, Berker D, Bayraktar M, Gürlek A (2014) Early promising results for the endoscopic surgical treatment of Cushing’s disease. Neurosurg Rev 37:105-114

  18. Netea-Maier RT, van Lindert EJ, den Heijer M, van der Eerden A, Pieters GF, Sweep CG et al (2006) Transsphenoidal pituitary surgery via the endoscopic technique: results in 35 consecutive patients with Cushing’s disease. Eur J Endocrinol 154(5):675–684

    Article CAS PubMed Google Scholar

  19. Dehdashti AR, Gentili F (2007) Current state of the art in the diagnosis and surgical treatment of cushing disease: early experience with a purely endoscopic endonasal technique. Neurosurg Focus 23(3):E9

    Article PubMed Google Scholar

  20. Starke RM, Reames DL, Chen CJ, Laws ER, Jane JA (2013) Jr. Endoscopic transsphenoidal surgery for cushing disease: techniques, outcomes, and predictors of remission. Neurosurgery 72(2):240–247 discussion 7

    Article PubMed Google Scholar

  21. Sarkar S, Rajaratnam S, Chacko G, Mani S, Hesargatta AS, Chacko AG (2016) Pure endoscopic transsphenoidal surgery for functional pituitary adenomas: outcomes with Cushing’s disease. Acta Neurochir (Wien) 158(1):77–86 discussion

    Article PubMed Google Scholar

  22. Cebula H, Baussart B, Villa C, Assié G, Boulin A, Foubert L et al (2017) Efficacy of endoscopic endonasal transsphenoidal surgery for Cushing’s disease in 230 patients with positive and negative MRI. Acta Neurochir (Wien) 159(7):1227–1236

    Article PubMed Google Scholar

  23. Wagenmakers MA, Boogaarts HD, Roerink SH, Timmers HJ, Stikkelbroeck NM, Smit JW et al (2013) Endoscopic transsphenoidal pituitary surgery: a good and safe primary treatment option for Cushing’s disease, even in case of macroadenomas or invasive adenomas. Eur J Endocrinol 169(3):329–337

    Article CAS PubMed Google Scholar

  24. Esquenazi Y, Essayed WI, Singh H, Mauer E, Ahmed M, Christos PJ, Schwartz TH (2017) Endoscopic endonasal Versus Microscopic Transsphenoidal surgery for recurrent and/or residual pituitary adenomas. World Neurosurg 101:186–195

    Article PubMed PubMed Central Google Scholar

  25. Cavallo LM, Solari D, Tasiou A, Esposito F, de Angelis M, D’Enza AI, Cappabianca P (2013) Endoscopic endonasal transsphenoidal removal of recurrent and regrowing pituitary adenomas: experience on a 59-patient series. World Neurosurg 80(3–4):342–350

    Article PubMed Google Scholar

  26. Perlman JE, Johnston PC, Hui F et al (2021) Pitfalls in performing and interpreting Inferior Petrosal Sinus Sampling: personal experience and literature review. J Clin Endocrinol Metab 106(5):e1953–e1967. https://doi.org/10.1210/clinem/dgab012

    Article PubMed PubMed Central Google Scholar

  27. Yogi-Morren D, Habra MA, Faiman C et al (2015) Pituitary MRI findings in patients with pituitary and ectopic ACTH-dependent cushing syndrome: does a 6-mm pituitary tumor size cut-off value exclude ectopic ACTH syndrome? Endocr Pract 21(10):1098–1103

    Article Google Scholar

  28. Negm HM, Al-Mahfoudh R, Pai M, Singh H, Cohen S, Dhandapani S et al (2017) Reoperative endoscopic endonasal surgery for residual or recurrent pituitary adenomas. J Neurosurg 127(2):397–408

    Article PubMed Google Scholar

  29. Cooke RS, Jones RA (1994) Experience with the direct transnasal transsphenoidal approach to the pituitary fossa. Br J Neurosurg 8(2):193–196

    Article CAS PubMed Google Scholar

  30. Chee GH, Mathias DB, James RA, Kendall-Taylor P (2001) Transsphenoidal pituitary surgery in Cushing’s disease: can we predict outcome? Clin Endocrinol (Oxf) 54(5):617–626

    Article CAS PubMed Google Scholar

  31. Atkinson AB, Kennedy A, Wiggam MI, McCance DR, Sheridan B (2005) Long-term remission rates after pituitary surgery for Cushing’s disease: the need for long-term surveillance. Clin Endocrinol (Oxf) 63(5):549–559

    Article PubMed Google Scholar

  32. Yap LB, Turner HE, Adams CB, Wass JA (2002) Undetectable postoperative cortisol does not always predict long-term remission in Cushing’s disease: a single centre audit. Clin Endocrinol (Oxf) 56(1):25–31

    Article CAS PubMed Google Scholar

  33. Liu X, Dai C, Bao X, Deng K, Yao Y, Sun B et al (2021) Treatment and outcomes of recurrent/persistent Cushing’s disease: a single-center experience. Ann Palliat Med 10(3):2494–2504

    Article PubMed Google Scholar

  34. Valderrábano P, Aller J, García-Valdecasas L, García-Uría J, Martín L, Palacios N, Estrada J (2014) Results of repeated transsphenoidal surgery in Cushing’s disease. Long-term follow-up. Endocrinol Nutr 61(4):176–183

    Article PubMed Google Scholar

  35. Wang B, Zheng S, Ren J, Zhong Z, Jiang H, Sun Q et al (2022) Reoperation for Recurrent and Persistent Cushing’s Disease without Visible MRI Findings. J Clin Med 11(22): 6848

  36. Burke WT, Penn DL, Repetti CS, Iuliano S, Laws ERJ (2019) Outcomes after repeat transsphenoidal surgery for recurrent Cushing Disease: updated. Neurosurgery 85(6):E1030–E6

    Article PubMed Google Scholar

  37. Bakiri F, Tatai S, Aouali R, Semrouni M, Derome P, Chitour F, Benmiloud M (1996) Treatment of Cushing’s disease by transsphenoidal, pituitary microsurgery: prognosis factors and long-term follow-up. J Endocrinol Invest 19(9):572–580

    Article CAS PubMed Google Scholar

  38. Dickerman RD, Oldfield EH (2002) Basis of persistent and recurrent cushing disease: an analysis of findings at repeated pituitary surgery. J Neurosurg 97(6):1343–1349

    Article PubMed Google Scholar

  39. Patil CG, Prevedello DM, Lad SP, Vance ML, Thorner MO, Katznelson L, Laws ER (2008) Jr. Late recurrences of Cushing’s disease after initial successful transsphenoidal surgery. J Clin Endocrinol Metab 93(2):358–362

    Article CAS PubMed Google Scholar

  40. Castinetti F, Brue T, Ragnarsson O (2019) Radiotherapy as a tool for the treatment of Cushing’s disease. Eur J Endocrinol 180(5):D9–d18

    Article PubMed Google Scholar

  41. Tajudeen BA, Mundi J, Suh JD, Bergsneider M, Wang MB (2015) Endoscopic endonasal surgery for recurrent pituitary tumors: technical challenges to the surgical approach. J Neurol Surg B Skull Base 76(1):50–56

    Article PubMed Google Scholar

  42. Hwang JM, Kim YH, Kim JW, Kim DG, Jung HW, Chung YS (2013) Feasibility of endoscopic endonasal approach for recurrent pituitary adenomas after microscopic trans-sphenoidal approach. J Korean Neurosurg Soc 54(4):317–322

    Article PubMed PubMed Central Google Scholar

  43. Berker M, Hazer DB, Yücel T, Gürlek A, Cila A, Aldur M, Onerci M (2012) Complications of endoscopic surgery of the pituitary adenomas: analysis of 570 patients and review of the literature. Pituitary 15(3):288–300

    Article PubMed Google Scholar

  44. Rudnik A, Zawadzki T, Wojtacha M, Bazowski P, Zubgałuszka-Ignasiak B, Duda I (2005) [Endoscopic transsphenoidal treatment of pituitary adenomas]. Neurol Neurochir Pol 39(1):17–23 discussion 4–5

    PubMed Google Scholar

  45. Minniti G, Osti M, Jaffrain-Rea ML, Esposito V, Cantore G, Maurizi Enrici R (2007) Long-term follow-up results of postoperative radiation therapy for Cushing’s disease. J Neurooncol 84(1):79–84

    Article PubMed Google Scholar

  46. Estrada J, Boronat M, Mielgo M, Magallón R, Millan I, Díez S et al (1997) The long-term outcome of pituitary irradiation after unsuccessful transsphenoidal surgery in Cushing’s disease. N Engl J Med 336(3):172–177

    Article CAS PubMed Google Scholar

  47. Littley MD, Shalet SM, Beardwell CG, Ahmed SR, Sutton ML (1990) Long-term follow-up of low-dose external pituitary irradiation for Cushing’s disease. Clin Endocrinol (Oxf) 33(4):445–455

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

Not applicable.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK).

Author information

Authors and Affiliations

  1. Department of Neurosurgery, Faculty of Medicine, Hacettepe University, Ankara, Turkey

    Sahin Hanalioglu, Muhammet Enes Gurses, Neslihan Nisa Gecici, Baylar Baylarov & Ilkay Isikay

  2. Department of Neurosurgery, Miller School of Medicine, University of Miami, Miami, FL, USA

    Muhammet Enes Gurses

  3. Department of Endocrinology and Metabolism, Faculty of Medicine, Hacettepe University, Ankara, Turkey

    Alper Gürlek

  4. Department of Neurosurgery, Hacettepe University School of Medicine, Sihhiye, Ankara, 06230, Turkey

    Mustafa Berker

Contributions

Conceptualization: S.H, M.B; Methodology: S.H, M.E.G, N.N.G; Formal analysis and investigation: M.E.G, N.N.G, B.B; Writing – original draft preparation: N.N.G; Writing – review and editing: S.H, M.E.G, B.B, I.I, A.G, M.B; Supervision: S.H, I.I, A.G, M.B.

Corresponding author

Correspondence to Mustafa Berker.

Ethics declarations

Ethical approval

This study is approved by the ethics committee of the hospital where the research was conducted and informed consent is obtained from patients.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

About this article

Cite this article

Hanalioglu, S., Gurses, M.E., Gecici, N.N. et al. Repeat endoscopic endonasal transsphenoidal surgery for residual or recurrent cushing’s disease: safety, feasibility, and success. Pituitary (2024). https://doi.org/10.1007/s11102-024-01396-x

Download citation

Filed under: Cushing's, pituitary, Treatments | Tagged: , , , , | Leave a comment »

Repeat Endoscopic Endonasal Transsphenoidal Surgery for Residual or Recurrent Cushing’s Disease: Safety, Feasibility, and Success

Posted on May 20, 2024 by MaryO

Abstract

Purpose

The success and outcomes of repeat endoscopic transsphenoidal surgery (ETS) for residual or recurrent Cushing’s disease (CD) are underreported in the literature. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in these patients.

Methods

A retrospective analysis was conducted on 56 patients who underwent a total of 65 repeat ETS performed by a single neurosurgeon between January 2006 and December 2020. Data including demographic, clinical, laboratory, radiological, and operational details were collected from electronic medical records. Logistic regression was used to identify potential predictors associated with sustained remission.

Results

Among the cases, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had prior endoscopic procedures. Remission was achieved in 47 (83.9%) patients after the first repeat ETS, with an additional 9 (16.1%) achieving remission after the second repeat procedure. During an average follow-up period of 97.25 months, the recurrence rate post repeat surgery was 6.38%. Sustained remission was achieved in 48 patients (85.7%), with 44 after the first repeat ETS and 4 following the second repeat ETS. Complications included transient diabetes insipidus (DI) in 5 (7.6%) patients, permanent (DI) in 2 (3%) patients, and one case (1.5%) of panhypopituitarism. Three patients (4.6%) experienced rhinorrhea requiring reoperation. A serum cortisol level > 5 µg/dL on postoperative day 1 was associated with a reduced likelihood of sustained remission.

Conclusion

Repeat ETS is a safe and effective treatment option for residual or recurrent CD with satisfactory remission rates and low rates of complications.

Introduction

Cushing’s disease (CD) arises from an adrenocorticotropic hormone (ACTH)-secreting pituitary adenoma, leading to excessive endogenous glucocorticoid production [ 1 ]. The reported incidence of CD varies from 0.7 to 2.4 cases per million individuals annually [ 2 ‐ 6 ]. Hypercortisolism impacts every bodily system and is linked to increased morbidity and mortality risks [ 7 , 8 ]. Therefore, prompt CD diagnosis and management are crucial to enhance patient outcomes.
Transsphenoidal surgery remains the primary treatment for CD, and has been associated with satisfactory remission rates ranging from 65 to 94% [ 2 , 3 , 5 , 9 ‐ 11 ]. Two surgical techniques are utilized: microscopic and endoscopic approaches. While both methods are effective, studies indicate that endoscopic transsphenoidal surgery (ETS) offers higher rates of complete tumor removal and lower complication rates [ 12 ‐ 14 ]. ETS holds advantages over microscopic transsphenoidal surgery (MTS) due to superior tumor visualization, especially for laterally invasive tumors and macroadenomas [ 15 ]. Since its introduction in 1997, ETS has gained popularity and is now the standard surgical approach for managing CD [ 16 ].
Remission rates post-ETS for CD treatment range from 77 to 90% [ 17 ‐ 22 ]. Despite ETS’s technical benefits and favorable outcomes, recurrence rates for Cushing’s disease after successful ETS range between 5.6% and 22.8% [ 17 , 18 , 22 , 23 ]. Reoperating for residual or recurrent CD presents challenges due to altered surgical landmarks and scar tissue formation from previous surgeries, potentially elevating morbidity, and mortality risks [ 24 , 25 ]. Limited literature exists on the success and outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent CD. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in patients with residual or recurrent Cushing’s disease.

Methods

Study design

This is a retrospective cohort study of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease. All patients underwent endoscopic endonasal transsphenoidal surgery by the senior author between 2006 and 2020. The study protocol was approved by the local ethics committee for clinical studies.

Patient selection

The study participants were selected based on specific inclusion and exclusion criteria. Inclusion criteria were as follows: (i) a confirmed diagnosis of Cushing’s disease, (ii) prior transsphenoidal surgery, and (iii) confirmation of residual or recurrent CD through clinical, laboratory, and/or imaging assessments. Exclusion criteria included: (i) prior craniotomy without transsphenoidal surgery, (ii) previous radiotherapy before reoperation, (iii) inaccessible clinical, laboratory, or radiological data, and (iv) follow-up duration of less than 6 months.

Diagnostic criteria

Each patient underwent thorough screening for active Cushing’s disease. An increased 24-hour urine cortisol level > 45 µg/day or a serum fasting cortisol level exceeding 1.8 µg/dl following a low-dose (2 mg) dexamethasone suppression test was deemed abnormal. Subsequently, a high-dose (8 mg) dexamethasone test was administered, and a reduction of 50% or more from the baseline value was indicative of active Cushing’s disease. Due to the technical limitations of the institution that the research has been done, late-night salivary cortisol tests were not performed. Early remission was characterized by a fasting serum cortisol level below 5 µg/dl on the 1st and 7th postoperative days. Patients displaying a serum cortisol level below 1.8 µg/dl after the low-dose dexamethasone suppression test or those requiring continued corticosteroid replacement post-surgery were considered to maintain remission. The presence of a residual adenoma on postoperative magnetic resonance imaging (MRI) confirmed residual disease.

Routine follow-up protocol

Patients were evaluated for Cushing’s disease symptoms before surgery and monitored at 6 months after surgery, as well as during annual check-ups for any changes in their condition. Fasting serum ACTH and cortisol levels were measured in the morning before surgery, on the 1st and 7th days after surgery, at the 1st, 3rd, and 6th months, and during annual follow-up appointments. Prior to surgery, all patients underwent contrast-enhanced pituitary MRI and paranasal sinus CT scans. Follow-up pituitary MRI scans were conducted on the 1st day, at 3 and 12 months after surgery, and then annually thereafter.

Data collection

Data from electronic medical records were gathered, encompassing demographic, clinical, laboratory, radiological, and operational details. Laboratory assessments comprised an anterior pituitary hormone panel (Follicle-stimulating hormone [FSH], Luteinizing hormone [LH], Thyroid-stimulating hormone [TSH], Prolactin [PRL], Growth hormone [GH]), serum electrolytes, preoperative and postoperative serum ACTH, and cortisol levels. Patient records, along with CT and MRI scans, were scrutinized to document preoperative tumor characteristics such as size, multifocality, relationship with the cavernous sinus, Hardy-Wilson classification of sellar destruction, and suprasellar extension. Tumors larger than 10 mm were classified as macroadenomas. The operational database was examined to collect data on previous surgeries, including the number and dates of prior procedures, as well as the surgical techniques utilized. Outcome measures included remission rates and surgical complications.

Statistical analysis

Statistical analysis was conducted utilizing SPSS 23.0 software (IBM, New York). Two-group comparisons were performed using Chi-square and Fisher’s exact tests for categorical variables and Student’s t-test for continuous variables. Categorical variables were presented as numbers and percentages, while continuous variables were presented as means ± SD or median [IQR]. Logistic regression was performed to investigate potential predictors linked to sustained remission. A p-value of < 0.05 was considered statistically significant.

Results

Baseline characteristics

Supplementary File 1 displays the demographic characteristics of the patient cohort.
A retrospective analysis was conducted on 190 patients who underwent a total of 212 operations for CD at our department between January 2006 and December 2020. Among them, 56 patients, comprising 65 repeat endonasal transsphenoidal surgeries due to either recurrence ( n  = 18, 27.7% ) or residual disease ( n  = 47, 72.3%), were identified. The majority of patients were female ( n  = 48, 85.7%), with a mean age of 37.6 ± 12.4 years. Of the 56 patients, 43 (76.8%) were referred from another institution. Most patients ( n  = 42, 75%) had undergone only one prior surgery, while 12 patients (21.4%) had a history of two previous surgeries, and 2 patients (3.6%) had undergone three prior surgeries before referral to our center. The average follow-up duration since the first repeat ETS was 97.2 ± 36.8 months. The mean time to recurrence was 80.2 ± 61.1 months (median 75 months, range 23.2 to 103.5 months).

Hormonal data

Table  1 depicts the preoperative and postoperative serum ACTH and cortisol levels. The average preoperative serum cortisol levels for the entire patient cohort stood at 18.7 ± 11.1 µg/dL (median 17, range 12-24.6). The median preoperative 24-hour urine free cortisol level was 237 µg/day [188.5–425.5]. On the initial postoperative day, the mean serum cortisol levels for all patients were 13.4 ± 13.8 µg/dL (median 6.4, range 1.7–21). In 46.2% of cases ( n  = 30), cortisol levels on the first postoperative day were below 5 µg/dL (< 2 µg/dL in 33.8%). A comparison of the mean preoperative and postoperative serum ACTH and cortisol levels between the groups with residual disease and recurrence is detailed in Table  1 .
Table 1

Cohort overview and comparison of recurrence and residual disease groups
variable
Total ( n  = 65)
Residual disease ( n  = 47)
Recurrence ( n  = 18)
p -value
Technique of the previous surgery
< 0.001
 MTS
40 (61.5)
36 (76.6)
4 (22.2)
 ETS
25 (38.5)
11 (23.4)
14 (77.8)
Tumor size
 Microadenoma
41 (63.1)
30 (63.8)
11 (61.1)
0.839
 Macroadenoma
24 (36.9)
17 (36.2)
7 (38.9)
Multifocality
 Unifocal
50 (76.9)
37 (78.7)
13 (72.2)
0.743
 Bifocal
15 (23.1)
10 (21.3)
5 (27.8)
Relation to cavernous sinus
 Extension
21 (32.3)
15 (31.9)
6 (33.3)
0.589
 invasion
10 (15.4)
6 (12.8)
4 (22.2)
 No relationship
34 (52.3)
26 (55.3)
8 (44.4)
Hardy-Wilson Classification
0.339
 Degrees
  I
38 (58.5)
25 (59.5)
8 (57.1)
  II
16 (24.6)
8 (19)
5 (5)
  III
6 (9.2)
6 (14.3)
1 (7.1)
  IV
5 (7.7)
3 (7.1)
0 (0)
 stage
0.443
  A
30 (46.2)
19 (45.2)
7 (50)
  b
7 (10.8)
4 (9.5)
3 (21.4)
  C
2 (3.1)
2 (4.8)
0 (0)
  D
1 (1.5)
0 (0)
0 (0)
  E
25 (38.5)
17 (40.5)
4 (28.6)
Laboratory values
 Preoperative serum ACTH (pg/mL)
182.71 ± 577.08
60.5 [37.15–104.5]
220.7 ± 675.73
83.5 ± 61.7
0.395
 Preoperative serum cortisol (µg/dL)
18.75 ± 11.16
17 [12-24.65]
19.18 ± 12.11
17.64 ± 8.39
0.621
 Postoperative serum ACTH (pg/mL)
43.29 ± 50.2
25.5 [15.8–53.7]
43.07 ± 45.42
43.94 ± 63.96
0.953
 Postoperative serum cortisol (µg/dL)
13.41 ± 13.85
6.45 [1.77–21.01]
14.62 ± 14.52
10.25 ± 11.7
0.259
POD 1 Cortisol levels
0.700
 >5 µg/dL
35 (53.8)
26 (55.3)
9 (50)
 ≤5 µg/dL
30 (46.2)
21 (44.7)
9 (50)
Tumor pathology
0.198
 ACTH + adenoma
55 (85)
40 (85.1)
15 (83.3)
 Crooke degeneration
2 (3)
1 (2.1)
1 (5.6)
 Pituitary hyperplasia
2 (3)
1 (2.1)
1 (5.6)
 Normal pituitary tissue
6 (9)
5 (10.6)
1 (5.6)
Result of reoperation
0.740
 Remission
51 (78.5)
36 (76.6)
15 (83.3)
 Residual disease
14 (21.5)
11 (23.4)
3 (16.7)
Values ​​are shown as number (%), mean ± SD or median [IQR] unless otherwise indicated
Abbreviations MTS, microscopic transsphenoidal surgery; ETS, endoscopic transsphenoidal surgery; ACTH, adrenocorticotropic hormone; POD 1, postoperative day 1

Radiological findings

In the entire case cohort, there were 41 microadenomas (63.1%) and 24 macroadenomas (36.9%). Fifteen cases (23.1%) exhibited bifocal adenomas. Adenoma extension into the cavernous sinuses, indicated by cavernous sinus wall displacement, was present in 21 cases (32.3%), while invasion into the cavernous sinuses was observed in 10 cases (15.4%). Based on the Hardy-Wilson Classification, there were 38 Grade I adenomas (58.5%), 16 Grade II adenomas (24.6%), 6 Grade III adenomas (9.2%), and 5 Grade IV adenomas (7.7%). Thirty patients (46.2%) presented with Stage A adenoma, 7 (10.8%) with Stage B adenoma, 2 (3.1%) with Stage C adenoma, 1 (1.5%) with Stage D adenoma, and 25 (38.5%) with Stage E adenoma. As indicated in Table  1 , there were no statistically significant differences between patients with residual disease and recurrence concerning radiological findings.

Surgical characteristics

A single surgeon conducted all 65 reoperations. Among these, 47 patients (72.3%) underwent repeat ETS due to residual disease, while 18 (27.7%) did so due to recurrence. The previous surgical technique was microscopic in 40 cases (61.5%) and endoscopic in 25 cases (38.5%). Microscopic transsphenoidal surgeries were exclusively performed at other institutions. There was a notable disparity between patients with residual disease and recurrence regarding the technique of the previous surgery. Residual disease occurrence following endoscopic transsphenoidal surgery was less frequent ( n  = 11/25, 44%) compared to after microscopic transsphenoidal surgery ( n  = 36/40, 90%; p  < 0.001) (Table  1 ). Immunohistochemical staining of the specimens indicated that 55 cases (85%) exhibited ACTH-positive adenoma. Nevertheless, all patients with a negative pathology at the repeat surgery had a confirmed ACTH adenoma at the first surgery. Of the 10 patients (15%) with a negative ACTH-positive adenoma pathology, two patients underwent inferior petrosal sinus sampling (IPSS) previously and were confirmed to have CD. Remaining patients did not undergo an additional inferior petrosal sinus sampling (IPSS) because all functional test results indicated a central source and MRI confirmed pituitary microadenoma in all cases. Notably, there are studies reporting that IPSS may not be required in patients with a sellar mass and a biochemical testing suggestive of CD [ 26 , 27 ]. Additionally, we also explored both sides of the pituitary and confirmed the adenoma intraoperatively. Therefore, negative pathology in the repeat surgery is most likely due to sampling error.

Outcomes

As depicted in Fig.  1 , among the 56 patients, 47 (83.9%) experienced initial remission following the first repeat ETS, while 9 (16.1%) still had residual adenoma. Within the group achieving initial remission, 44 patients (93.6%) maintained remission without the need for further surgeries, while 3 (6.4%) experienced recurrence during follow-up and required a second repeat ETS.

https://static-content.springer.com/image/art%3A10.1007%2Fs11102-024-01396-x/MediaObjects/11102_2024_1396_Fig1_HTML.png

Fig. 1

Outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease
Among the 9 patients with residual disease after the first repeat ETS, 1 (11.1%) opted to defer further treatment, 1 (11.1%) received radiotherapy, 1 (11.1%) chose adrenalectomy, and 6 (66.7%) underwent a second repeat ETS. Of the 9 patients who underwent a second repeat ETS due to residual disease or recurrence, 4 (44.4%) sustained remission, 5 (55.6%) still had residual disease, but 3 of them deferred further treatment, 1 received radiotherapy, while 1 achieved remission after adrenalectomy. Overall, 78.5% ( n  = 51) of the entire case cohort achieved remission following repeat ETS. Representative cases are presented in Fig.  2 .

https://static-content.springer.com/image/art%3A10.1007%2Fs11102-024-01396-x/MediaObjects/11102_2024_1396_Fig2_HTML.png

Fig. 2

Case 1: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 49-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 14 years ago at an outside institution. Preoperative T2 ( A ), and T1 contrast-enhanced ( B ) MRI scans demonstrate a right-sided pituitary adenoma. Postoperative T2 ( C ), and T1 contrast-enhanced ( D ) MRI scans demonstrate total resection of the adenoma. Case 2: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 53-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 3 years ago at an outside institution. Preoperative T2 ( E ), and T1 contrast-enhanced ( F ) MRI scans demonstrate a left-sided pituitary adenoma, in close relation to ICA. Postoperative T2 ( G ), and T1 contrast-enhanced ( H ) MRI scans demonstrate total resection of the adenoma
Transient diabetes insipidus (DI) developed in 5 patients (7.6%), while 2 (3%) experienced permanent DI following repeat ETS. Intraoperative cerebrospinal fluid (CSF) leak occurred in 20 operations (30.7%). Three patients (4.6%) developed rhinorrhea and required reoperation. Five patients (7.6%) developed prolactin deficiency, 3 patients (4.6%) had GH deficiency, and another 3 patients (4.6%) had TSH deficiency requiring thyroxine replacement. Four patients (6.2%) had combined deficiencies in TSH, FSH, LH and prolactin, while one patient (1.5%) developed panhypopituitarism following the second repeat ETS.

Factors predisposing to unsuccessful repeat endoscopic transsphenoidal surgery

Among the 42 patients who underwent repeat ETS for residual disease, 9 (21.4%) still had residual disease after the first repeat ETS. We conducted a multivariable logistic regression analysis to explore potential risk factors for unsuccessful repeat ETS. However, the analysis did not reveal any significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size (Supplementary File 1 ).

Potential predictors of sustained remission

We conducted a multivariable logistic regression analysis to investigate possible predictors of sustained remission. The variables included in the analysis are detailed in Table 5. The results indicated that having a serum cortisol level exceeding 5 µg/dL on postoperative day 1 was linked to a decreased likelihood of achieving sustained remission (odds ratio [OR] 0.09, 95% confidence interval [CI] 0.01–0.52, p  = 0.006) (Table  2 ).
Table 2

Logistic regression analysis of potential predictors for continued remission
variable
OR (95% CI)
p -value
Age
1.003 (0.94–1.06)
0.913
Gender
 Female
Reference
 times
0.43 (0.06–2.88)
0.387
Indication for repeat ETS
 Residual disease
Reference
 Recurrence
1.2 (0.25–5.68)
0.812
Tumor size
 Microadenoma
Reference
 Macroadenoma
0.94 (0.18–4.79)
0.948
Relation to cavernous sinus
 No relation
Reference
 Extension invasion
0 (0)
0.999
Hardy-Wilson Classification
 Degrees
  I-II
Reference
  III-IV
3.2 (0.3-34.06)
0.334
 stage
  AC
Reference
  EN
0 (0)
0.999
POD 1 Cortisol levels
 ≤5 µg/dL
Reference
 >5 µg/dL
0.09 (0.01–0.52)
0.006
Abbreviations ETS, endoscopic transsphenoidal surgery; POD 1, postoperative day 1

Discussion

Transsphenoidal surgery remains the established standard for treating Cushing’s disease, with demonstrated remission rates ranging from 65 to 94%, contingent upon the surgeon’s expertise and remission criteria [ 2 , 3 , 5 , 9 ‐ 11 ]. The advent of endoscopic techniques has significantly augmented this approach, offering greater visibility, reduced nasal trauma, and shorter hospital stays [ 16 , 25 , 28 , 29 ]. While the effectiveness of ETS in managing CD is well-documented, literature on its efficacy in treating residual or recurrent cases is limited. Our study addresses this gap by assessing the safety, feasibility, and outcomes of repeat ETS for patients with persistent or recurrent Cushing’s disease.
In our study, 56 patients underwent 65 repeat ETS procedures for residual or recurrent Cushing’s disease. Mean follow-up duration was 97.2 ± 36.8 months, which is one of the longest follow-up durations that has been reported following repeat endoscopic transsphenoidal surgery [ 5 , 30 ‐ 32 ]. Of these patients, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had undergone prior endoscopic procedures. Importantly, a notable difference emerged between patients with residual disease and those experiencing recurrence regarding the prior surgical approach, with residual disease being less frequent after endoscopic surgery compared to microscopic surgery ( p  < 0.001). This variance was expected, as numerous studies have indicated that ETS yields a higher rate of complete resection compared to MTS [ 12 ‐ 14 ].
After the first repeat ETS, 47 patients (83.9%) achieved remission, and 78.5% ( n  = 44) of them maintained remission at a mean follow-up of 97.2 months without requiring additional surgery. Limited data exists regarding the remission rates of CD following repeat transsphenoidal surgery, with reported rates ranging from 28.9 to 73% [ 33 , 34 , 35 ]. Burke et al. reported an immediate remission rate of 86.7% and a continued remission rate of 73.3% at follow-up after repeat ETS [ 36 ]. Among our patients who achieved remission after successful repeat ETS, 3 individuals (6.38%, n  = 3/47) experienced recurrence after the first repeat ETS, with a mean time to recurrence of 45.6 months. The rates of CD recurrence following reoperation vary, with documented rates ranging between 22% and 63.2% [ 37 , 38 ]. In our study, 9 patients required a second repeat ETS due to residual disease or recurrence. Of these, 4 (44.4%) achieved continued remission following the second repeat ETS, while 5 (55.6%) had residual disease; however, 4 of them deferred further treatment, and 1 achieved remission after adrenalectomy. In total, 47 patients (83.9%) in the entire patient cohort achieved remission following endoscopic transsphenoidal surgery and did not require further intervention.
Within our case cohort, among the 42 patients who underwent repeat ETS for residual disease, 9 individuals (21.4%) continued to exhibit residual disease following the first repeat ETS. We did not establish a significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size.
The degree of hypocortisolism following transsphenoidal surgery is considered a potential indicator of remission in the postoperative period [ 3 ]. Numerous studies have indicated that patients with subnormal postoperative cortisol levels tend to experience a lower recurrence rate compared to those with normal or supranormal levels, although consensus on the precise cutoff level remains elusive [ 30 ‐ 32 , 39 ]. In a retrospective study involving 52 patients with CD, researchers reported a 100% positive predictive value of a postoperative nadir cortisol level < 2 µg/dL for achieving remission [ 5 ]. Additionally, Esposito et al. observed that a morning serum cortisol level ≤ 5 µg/dL on postoperative day 1 or 2 appears to serve as a reliable predictor of remission [ 11 ]. In our investigation, logistic regression analysis revealed that patients with a serum cortisol level > 5 µg/dL on postoperative day 1 were less inclined to achieve continued remission compared to those with a serum cortisol level < 5 µg/dL on postoperative day 1.
Repeat transsphenoidal surgery presents unique challenges due to distorted surgical landmarks and the presence of scar tissue from prior procedures, often resulting in lower cure rates and increased morbidity risk [ 24 , 25 , 28 ]. Non-surgical options such as radiotherapy and radiosurgery have been considered as an effective treatment option for recurrent or residual CD due to low rates of morbidity and acceptable remission rates [ 28 , 40 ]. However, our findings suggest that the outcomes and complication rates associated with repeat ETS are comparable to primary ETS for CD and superior to other non-surgical options for residual or recurrent CD. Within our patient cohort, 5 (7.6%) individuals experienced transient diabetes insipidus (DI), while 2 (3%) developed permanent DI. Additionally, one patient (1.5%) experienced panhypopituitarism following the second repeat ETS. Similarly, various studies have reported DI rates ranging from 2 to 13% and panhypopituitarism rates between 2% and 9.7% [ 25 , 28 , 41 ‐ 43 ]. In our series, 3 (5.3%) patients developed rhinorrhea and required reoperation, consistent with reported rates of postoperative CSF leak ranging from 1 to 5% following repeat endoscopic transsphenoidal surgery for residual or recurrent pituitary tumors [ 25 , 28 , 44 ]. While radiotherapy and radiosurgery are options for patients who have failed transsphenoidal surgery or experienced recurrence, the literature suggests remission rates ranging from 46 to 84%, with several studies indicating high recurrence rates (25-50%) following radiotherapy [ 40 , 45 ‐ 47 ]. In our study, among 56 patients, 47 (83.9%) achieved remission following the first repeat ETS, while 4 (17.8%) achieved remission after the second repeat ETS. Over a mean follow-up duration of 97.25 months, our recurrence rate following repeat ETS was 27.7%, with a mean time to recurrence of 45.62 months.
At our institution, we adhere to a specific algorithm (Fig.  3 ) for managing Cushing’s disease patients and implement a meticulous protocol for individuals undergoing repeat ETS for residual or recurrent CD. A thorough clinical and radiological assessment is conducted for all patients before surgery. Detailed radiological evaluation is particularly essential to identify any distortions in surgical landmarks from prior procedures, such as the course of sphenoidal septa and the location of the sellar floor opening, as well as other potential aberrations like internal carotid artery and optic nerve dehiscence. Imaging techniques should encompass dynamic pituitary MRI with and without contrast and paranasal CT scans. Our objective is to achieve extensive exposure during surgery, which is especially critical for managing bifocal adenomas or adenomas with cavernous sinus invasion or extension. The expanded visual field also facilitates the visualization of concealed parts of the adenoma, allowing the surgeon to achieve complete resection, which may be challenging or even impossible with limited exposure. We employ a multilayer closure technique to prevent CSF leaks, and if necessary, utilize a vascularized pedicled nasoseptal flap (Hadad-Bassagasteguy flap).

https://static-content.springer.com/image/art%3A10.1007%2Fs11102-024-01396-x/MediaObjects/11102_2024_1396_Fig3_HTML.png

Fig. 3

Specific algorithm for the management of Cushing’s disease patients
In summary, our findings suggest that in the hands of experienced surgeons, repeat ETS represents a safe and effective treatment option for managing residual or recurrent Cushing’s disease.

Strengths and limitations

Our study represents one of the largest case series in the literature examining the safety, feasibility, and efficacy of repeat ETS for managing recurrent or residual CD. Our findings underscore the safety and efficacy of repeat ETS in experienced centers, showcasing satisfactory remission rates and minimal complications. However, it is important to acknowledge the retrospective nature of our study, which inherently introduces potential biases such as selection bias. Lastly, our study exclusively focuses on patients undergoing surgical intervention for recurrent or residual CD, limiting our ability to compare the effectiveness of surgical treatment with alternative modalities like radiotherapy or radiosurgery.

Conclusion

Our study underscores the efficacy and safety of repeat endoscopic transsphenoidal surgery in managing residual or recurrent Cushing’s disease. Remarkably, 82.1% of patients achieved remission after their first reoperation, aligning closely with reported remission rates following primary endoscopic transsphenoidal surgery. Furthermore, the complication rates observed in our cohort were consistent with documented rates for both primary and repeat transsphenoidal surgeries. Notably, patients with serum cortisol levels < 5 µg/dL are more likely to maintain remission. Overall, our findings emphasize that in the hands of experienced surgeons, repeat endoscopic transsphenoidal surgery emerges as a reliable and safe treatment modality for residual or recurrent Cushing’s disease, offering satisfactory remission rates and minimal complications.

Acknowledgments

Not applicable.

Declarations

Ethical approval

This study is approved by the ethics committee of the hospital where the research was conducted and informed consent is obtained from patients.

Competing interests

The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​ .

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

 

Filed under: Cushing's, pituitary, Treatments | Tagged: , , , , | Leave a comment »

Day 20, Cushing’s Awareness Challenge

Posted on April 20, 2024 by MaryO

And today, we talk about pink jeeps and ziplines…

How in the world did we get here in a Cushing’s Challenge?  I’m sliding these in because earlier I linked (possibly!) my growth hormone use as a cause of my cancer – and I took the GH due to Cushing’s issues.  Clear?  LOL

I had found out that I had my kidney cancer on Friday, April 28, 2006 and my surgery on May 9, 2006.  I was supposed to go on a Cushie Cruise to Bermuda on May 14, 2006.  My surgeon said that there was no way I could go on that cruise and I could not postpone my surgery until after that cruise.

I got out of the hospital on the day that the other Cushies left for the cruise and realized that I wouldn’t have been much (ANY!) fun and I wouldn’t have had any.

An especially amusing thread from that cruise is The Adventures of Penelopee Cruise (on the Cushing’s Help message boards).  Someone had brought a UFC jug and  decorated her and had her pose around the ship.

The beginning text reads:

Penelopee had a lovely time on Explorer of the Seas which was a five day cruise to Bermuda. She needed something to cheer her up since her brother, Tom, went off the deep end, but that’s another story!

Penelopee wanted to take in all of the sights and sounds of this lovely vessel. Every day she needed to do at least one special thing. Being a Cushie, she didn’t have enough spoons to do too much every day.

On the first day, she went sunning on the Libido deck……she didn’t last too long, only about 10 minutes. Goodness, look at her color! Do you think maybe her ACTH is too high?

Although I missed this trip, I was feeling well enough to go to Sedona, Arizona in August, 2006.  I convinced everyone that I was well enough to go off-road in a pink jeep,  DH wanted to report me to my surgeon but I survived without to much pain and posed for the header image.

In 2009, I figured I have “extra years” since I survived the cancer and I wanted to do something kinda scary, yet fun. So, somehow, I decided on ziplining. Tom wouldn’t go with me but Michael would so I set this up almost as soon as we booked a Caribbean cruise to replace the Cushie Cruise to Bermuda.

Each person had a harness around their legs with attached pulleys and carabiners. Women had them on their chests as well. In addition, we had leather construction gloves and hard hats.

We climbed to the top of the first platform and were given brief instructions and off we went. Because of the heavy gloves, I couldn’t get any pictures. I had thought that they would take some of us on the hardest line to sell to us later but they didn’t. They also didn’t have cave pictures or T-Shirts. What a missed opportunity!

This was so cool, so much fun. I thought I might be afraid at first but I wasn’t. I just followed instructions and went.

Sometimes they told us to break. We did that with the right hand, which was always on the upper cable.

After the second line, I must have braked too soon because I stopped before I got to the platform. Michael was headed toward me. The guide on the end of the platform wanted me to do some hand over hand maneuver but I couldn’t figure out what he was saying so he came and got me by wrapping his legs around me and pulling me to the platform.

After that, no more problems with braking!

The next platform was very high – over 70 feet in the air – and the climb up was difficult. It was very hot and the rocks were very uneven. I don’t know that I would have gotten to the next platform if Michael hadn’t cheered me on all the way.

We zipped down the next six lines up to 250-feet between platforms and 85-feet high in the trees, at canopy level. It seemed like it was all over too soon.

But, I did it! No fear, just fun.

Enough of adventures – fun ones like these, and scary ones like transsphenoidal surgery and radical nephrectomy!

Filed under: Cancer, Cushing's | Tagged: , , , , , , , , , , , , , , , , | Leave a comment »

« Previous Page — Next Page »