Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Posted on July 23, 2024 by MaryO

Abstract

Objective

Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.

Methods

Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.

Results

In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.

Conclusion

Although the USP8–EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Peer Review reports

Introduction

Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [3, 4].

The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.

Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.

Methods

Case series

Study population

Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.

DNA extraction and Sanger sequencing

A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.

Systematic review

Overview of the systematic literature review

We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.

Search strategy

We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.

Inclusion and exclusion criteria

All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.

Results

Case series

Baseline characteristics of the participants

This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).

Frequency of USP8 gene variants

Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).

Fig. 1

figure 1

Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II

Clinical outcomes after surgery

All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).

Systematic review

The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.

Fig. 2
figure 2

Flow diagram of literature search and study selection

In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).

Table 1 Results of systematic literature review
Fig. 3

figure 3

Summary of USP8 mutations in patients with CD in selected studies

USP8 variants and the related pathways in corticotroph adenomas

In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].

Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].

Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].

A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].

DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].

Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma

Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].

In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].

A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].

USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma

Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].

In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].

A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].

Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].

Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].

The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].

Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].

Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].

Analytical conclusion

In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.

We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.

Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [6, 15]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.

Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.

Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [7, 24]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].

There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.

Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22, 25, 28, 30]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [24, 27, 42]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.

There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [30, 31]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [37, 38].

In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Data availability

The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.

Abbreviations

ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48

References

  1. Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.

  2. Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.

    Article CAS PubMed PubMed Central Google Scholar

  3. Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.

    Article CAS PubMed Google Scholar

  4. Mallari RJ, Thakur JD, Barkhoudarian G, Eisenberg A, Rodriguez A, Rettinger S, Cohan P, Nieman L, Kelly DF. Diagnostic pitfalls in Cushing Disease: Surgical Remission Rates, Test Thresholds, and lessons learned in 105 patients. J Clin Endocrinol Metab. 2022;107(1):205–18.

    Article PubMed Google Scholar

  5. Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.

    Article PubMed Google Scholar

  6. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.

    Article CAS PubMed Google Scholar

  7. Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.

    Article CAS PubMed PubMed Central Google Scholar

  8. Rebollar-Vega RG, Zuarth-Vázquez JM, Hernández-Ramírez LC. Clinical spectrum of USP8 pathogenic variants in Cushing’s Disease. Arch Med Res. 2023;54(8):102899.

    Article CAS PubMed Google Scholar

  9. Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.

    Article CAS PubMed PubMed Central Google Scholar

  10. Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.

    Article PubMed Google Scholar

  11. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.

    Article CAS PubMed PubMed Central Google Scholar

  12. Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.

  13. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.

    Article CAS PubMed Google Scholar

  14. Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.

    Article CAS PubMed Google Scholar

  15. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.

    Article CAS PubMed PubMed Central Google Scholar

  16. Martins CS, Camargo RC, Coeli-Lacchini FB, Saggioro FP, Moreira AC, de Castro M. USP8 mutations and cell cycle regulation in Corticotroph Adenomas. Horm Metab Res. 2020;52(2):117–23.

    Article CAS PubMed Google Scholar

  17. Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.

    Article CAS PubMed Google Scholar

  18. Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.

    Article CAS PubMed Google Scholar

  19. Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.

    Article PubMed PubMed Central Google Scholar

  20. Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.

    Article PubMed Google Scholar

  21. Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.

    Article PubMed Google Scholar

  22. Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.

    Article CAS PubMed PubMed Central Google Scholar

  23. Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.

    Article PubMed PubMed Central Google Scholar

  24. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.

  25. Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.

    Article CAS PubMed Google Scholar

  26. Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.

    Article CAS PubMed PubMed Central Google Scholar

  27. Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.

    Article CAS PubMed Google Scholar

  28. Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.

    Article CAS PubMed PubMed Central Google Scholar

  29. Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.

    Article CAS PubMed Google Scholar

  30. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.

    Article CAS PubMed Google Scholar

  31. Albani A, Perez-Rivas LG, Tang S, Simon J, Lucia KE, Colón-Bolea P, Schopohl J, Roeber S, Buchfelder M, Rotermund R, et al. Improved pasireotide response in USP8 mutant corticotroph tumours in vitro. Endocr Relat Cancer. 2022;29(8):503–11.

    Article CAS PubMed Google Scholar

  32. Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.

    Article CAS PubMed PubMed Central Google Scholar

  33. Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.

    Article CAS PubMed PubMed Central Google Scholar

  34. Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.

  35. Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.

    Article CAS PubMed Google Scholar

  36. Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.

    Article PubMed PubMed Central Google Scholar

  37. Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.

    Article CAS PubMed PubMed Central Google Scholar

  38. Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.

    Article CAS PubMed Google Scholar

  39. Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, Serban A, Ferrante E, Locatelli M, Lania AG, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. 2021;28(8):573–82.

    Article CAS PubMed Google Scholar

  40. Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.

    Article PubMed Google Scholar

  41. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.

    CAS PubMed Google Scholar

  42. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S. Transforming growth factor-alpha stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol. 2000;165(2):493–501.

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank all the participants enrolled in this study.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.

Author information

Author notes

  1. Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.

Authors and Affiliations

  1. Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran

    Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh

  2. Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran

    Ali Zare Mehrjardi

  3. Department of Endocrinology, Arad Hospital, Tehran, Iran

    Mahmoud Reza Kaynama

Contributions

Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad E. Khamseh.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Skip to figshare navigation

Below is the link to the electronic supplementary material.

Cite this article

Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord 24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z

Download citation

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable linkProvided by the Springer Nature SharedIt content-sharing initiative

Keywords

From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-024-01619-z

Filed under: Cushing's | Tagged: , , | Leave a comment »

Epigenetic Mechanisms Modulated by Glucocorticoids With a Focus on Cushing Syndrome

Posted on April 19, 2024 by MaryO

Abstract

In Cushing syndrome (CS), prolonged exposure to high cortisol levels results in a wide range of devastating effects causing multisystem morbidity. Despite the efficacy of treatment leading to disease remission and clinical improvement, hypercortisolism-induced complications may persist. Since glucocorticoids use the epigenetic machinery as a mechanism of action to modulate gene expression, the persistence of some comorbidities may be mediated by hypercortisolism-induced long-lasting epigenetic changes. Additionally, glucocorticoids influence microRNA expression, which is an important epigenetic regulator as it modulates gene expression without changing the DNA sequence. Evidence suggests that chronically elevated glucocorticoid levels may induce aberrant microRNA expression which may impact several cellular processes resulting in cardiometabolic disorders.

The present article reviews the evidence on epigenetic changes induced by (long-term) glucocorticoid exposure. Key aspects of some glucocorticoid-target genes and their implications in the context of CS are described. Lastly, the effects of epigenetic drugs influencing glucocorticoid effects are discussed for their ability to be potentially used as adjunctive therapy in CS.

epigenetic, glucocorticoids, Cushing syndrome
Issue Section:

Mini-review

In Cushing syndrome (CS), adrenocorticotropic hormone (ACTH) hypersecretion by a pituitary adenoma or an ectopic source, or autonomous cortisol hypersecretion by an adrenal tumor, induces chronic endogenous hypercortisolism with loss of the cortisol circadian rhythm (1). CS is more prevalent in women than men and frequently occurs in the fourth to sixth decades of life (2).

Glucocorticoids (GC) have extensive physiological actions and regulate up to 20% of the expressed genome, mainly related to the immune system, metabolic homeostasis, and cognition. Therefore, the prolonged exposure to high cortisol levels results in a wide range of devastating effects, including major changes in body composition (obesity, muscle atrophy, osteoporosis), neuropsychiatric disturbances (impaired cognition, depression, sleep disturbances), the metabolic syndrome (obesity, hypertension, insulin resistance, and dyslipidemia), hypercoagulability, and immune suppression (3, 4). The consequences of hypercortisolism lead to compromised quality of life and increased mortality rate (5). The mortality rate in patients with CS is 4 times higher than the healthy control population (6). Risk factors such as obesity, diabetes, and hypertension contribute to the increased risk of myocardial infarction, stroke, and cardiac insufficiency. As a result, cardiovascular disease is the leading cause of the premature death in CS (5). Infectious disease is also an important cause of death in CS (5). Therefore, prompt treatment to control hypercortisolism is imperative to prevent complications and an increased mortality rate.

Despite the efficacy of treatment leading to disease remission, the clinical burden of CS improves, but does not completely revert, in every patient (7). Indeed, obesity, neuropsychiatric disturbances, hypertension, diabetes, and osteoporosis persist in a substantial number of biochemically cured patients. For instance, in a study involving 118 CS patients in remission for about 7.8 years (median), resolution of comorbidities such as diabetes occurred in only 36% of cases, hypertension in 23% of cases, and depression in 52% of the cases (8). It has been proposed that epigenetic changes as a consequence of hypercortisolism is a mechanism of the persistence of some comorbidities (9-12).

Epigenetics is a reversible process that modifies gene expression without any alterations in DNA sequence; frequently it is mediated by histone modification and DNA methylation together with microRNAs (13-15). GCs use the epigenetic machinery as a mechanism of action to regulate gene expression in physiological circumstances, such as metabolic actions and stress response. Its networks involve DNA and histone modifying enzymes, such as DNA methyltransferases (DNMTs), histone acetyltransferases (HATs), and histone deacetylases (HDACs) (16). (Fig. 1) The DNA methylation process catalyzed by DNMTs is usually associated with downregulation of gene expression (17). Histone modifications catalyzed by HAT enzymes induce gene transcription, while those by HDAC enzymes induce transcriptional repression (17). Drugs interfering with these enzymes (so-called epigenetic drugs) may affect the GC genomic actions confirming the interaction between GC and the epigenetic system (18, 19). Furthermore, GC can modulate HDAC and DNMT expression and activity (16, 19, 20). Based on these data it might be speculated that in CS, epigenetic modifications induced by long-term GC exposure plays a role in the development of the disease-specific morbidity (9, 10).

Figure 1.
Glucocorticoid (GC) and its epigenetic machinery. GC through its receptor interacts with DNA and histone modifying enzymes, such as DNA methyltransferases (DNMTs), histone acetyl transferases (HATs), and histone deacetylases (HDAC) to modulate gene expression.

Open in new tabDownload slide

Glucocorticoid (GC) and its epigenetic machinery. GC through its receptor interacts with DNA and histone modifying enzymes, such as DNA methyltransferases (DNMTs), histone acetyl transferases (HATs), and histone deacetylases (HDAC) to modulate gene expression.

In this review we provide an overview of epigenetic aspects of GC action in physiological conditions and in the context of CS. We start with a detailed characterization of how GC, using the epigenetic system, can change chromatin structure in order to activate or silence gene expression. (Fig. 2) Subsequently, we describe the role of epigenetic mechanisms in the regulation of expression of several GC-target genes related to CS. Finally, we present the current evidence of epigenetic changes caused by the long-term of GC exposure and the potential use of epidrugs influencing GC actions.

Figure 2.
Epigenetic mechanisms of the glucocorticoid action to regulate gene expression. The GR is located in cytoplasm in a multi-protein complex; after GC binding, GR dissociates from the multi-protein complex, crosses the nuclear membrane, dimerizes, and binds to the GRE of the target gene. One of the mechanisms of action of GC is through the recruitment of co-regulators together with epigenetic enzymes, such as HAT, to change the chromatin structure, resulting in activation of gene transcription. Also, GR decreases gene expression by tethering other transcriptional factors and recruiting HDAC2, causing histone deacetylation, which leads to a repressed chromatin. GC can cause hypomethylation through downregulation in the expression of DNMT1. Abbreviations: Ac, acetylation; DNMT1, DNA methyltransferase 1; GC, glucocorticoid; GR, glucocorticoid receptor; GRE, glucocorticoid responsive elements; HAT, histone acetyltransferase; HDAC, histone deacetylases; Me: methylation.

Open in new tabDownload slide

Epigenetic mechanisms of the glucocorticoid action to regulate gene expression. The GR is located in cytoplasm in a multi-protein complex; after GC binding, GR dissociates from the multi-protein complex, crosses the nuclear membrane, dimerizes, and binds to the GRE of the target gene. One of the mechanisms of action of GC is through the recruitment of co-regulators together with epigenetic enzymes, such as HAT, to change the chromatin structure, resulting in activation of gene transcription. Also, GR decreases gene expression by tethering other transcriptional factors and recruiting HDAC2, causing histone deacetylation, which leads to a repressed chromatin. GC can cause hypomethylation through downregulation in the expression of DNMT1. Abbreviations: Ac, acetylation; DNMT1, DNA methyltransferase 1; GC, glucocorticoid; GR, glucocorticoid receptor; GRE, glucocorticoid responsive elements; HAT, histone acetyltransferase; HDAC, histone deacetylases; Me: methylation.

Search Strategy

A search of the PubMed database was conducted using the advanced search builder tool for articles in the English language on the following terms “glucocorticoids,” “glucocorticoid receptor,” “Cushing,” “hypercortisolism,” “epigenetic,” “DNA methylation,” “histone deacetylase,” “histone acetyltransferase,” “microRNA” “fkbp5,” “clock genes,” and “POMC.” Moreover, references were identified directly from the articles included in this manuscript. The articles were selected by the authors after being carefully analyzed regarding their importance and impact.

Epigenetic Aspects of Genomic Action of Glucocorticoids

GCs regulate gene expression positively or negatively. GC-responsive genes include genes encoding for proteins associated with inflammation, metabolic processes, blood pressure and fluid homeostasis, apoptosis, cell cycle progression, circadian rhythm, and intracellular signaling (21).

The GC actions are cell type–specific (22). For instance, in an in vitro study, the comparison of GC-expressed genes between 2 cell lines, corticotroph (AtT20) and mammary (3134) cell lines, showed a different set of GC-regulated genes, revealing the cell type–specific nature of GC effects (23). GC function depends on the accessibility of glucocorticoid receptor (GR)-binding sites in the DNA of the target tissue, which in turn is mostly established during cell differentiation. Therefore, different chromatin organization explains the distinct GR-binding sites among different tissues (22, 24, 25). The chromatin accessibility is determined by histone modifications such as acetylation, methylation, phosphorylation, and/or DNA methylation, processes that are both dynamic and reversible (26).

Furthermore, gene expression is regulated in a GC-concentration-dependent manner which is tissue-specific. Only a few genes can be upregulated or downregulated at low concentrations of GC. For example, a dose of dexamethasone (Dex) as low as 0.5 nM selectively activated PER1 (period 1, transcription factor related to circadian rhythm) expression in lung cancer (A549) cells (21, 27). Additionally, continuous GC exposure or pulsed GC (cortisol fluctuation during circadian rhythm) may cause different responses with respect to gene expression (26, 28). For example, constant treatment with corticosterone induced higher levels of PER1 clock gene mRNA expression compared with pulsatile treatment, as demonstrated in an in vitro study using 3134 cell line (28).

The time course for gene expression in response to Dex is fast, with repression occurring slightly slower compared to activation. Half of activated and repressed genes are detected within, respectively, about 40 minutes and 53 minutes following Dex exposure (21).

In short, the transcriptional output in response to GC depends on cell type, as well as on the duration and intensity of GC exposure (21, 24, 26, 27). GCs act as a transcriptional regulatory factor resulting in activating or repressing the expression of genes. The GC exerts its function through binding to corticosteroid receptors, specifically, the mineralocorticoid receptor and the GR, members of the nuclear receptor superfamily (29, 30).

Glucocorticoid Receptor

The GR is located in the cytoplasm in a chaperone complex which includes heat-shock proteins (70 and 90) and immunophilins (such as FK506 binding protein [FKBP5]). Cortisol diffuses across the cell membrane and binds with high affinity to the GR. The activated GR bound to GC dissociates of the multi-protein complex and is transferred to the nucleus, where it ultimately regulates gene expression (26, 31).

GR is a transcription factor encoded by nuclear receptor subfamily 3, group C member 1 (NR3C1) gene, located in chromosome 5, and consisting of 9 exons. It is composed of 3 major functional domains, namely a DNA binding domain (DBD), the C-terminal ligand-binding domain (LBD) and the N-terminal domain (NTB). The LBD recognizes and joins the GC. NTB contains an activation function-1 (AF1) which connects with co-regulators and the members of the general transcription machinery to activate target genes. The DBD comprises 2 zinc fingers motifs that are able to identify and bind to glucocorticoid responsive elements (GREs) (32, 33).

GRα is the most expressed and functionally active GR. GRβ is another isoform which is the result of an alternative splicing in exon 9 of the GR transcript. The difference between the 2 isoforms is the distinct ligand-binding domain in GRβ. This variance prevents the GRβ from binding to GC. In fact, the GRβ counteracts GRα function by interfering with its binding to a GRE in the target gene, and GRβ expression is associated with GC resistance (32). In addition, GRβ has its own transcriptional activity which is independent and distinct from GRα (34).

Another splice variant of human GR, GRγ, is associated with GC resistance in lung cell carcinoma and childhood acute lymphoblastic leukemia (33, 35). There is an additional amino acid (arginine) in the DBD of the GRγ that reduces, by about half, the capacity to activate or suppress the transcription of the target gene, as compared with GRα (32). One study identified GRγ in a small series of corticotroph adenomas (36).

Glucocorticoid Mechanism of Action

The GR-GC complex induces or represses gene expression directly by binding to DNA, indirectly by tethering other transcription factors or yet in a composite manner that consists in binding DNA in association with binding to other co-regulators (35, 37).

The GR has the ability to reorganize the chromatin structure to become more or less accessible to the transcriptional machinery. In the classical mechanism of direct induction of gene expression, the GR dimerizes and binds to a GRE in DNA. The receptor recruits co-regulators, such as CREB binding protein, which has intrinsic histone acetyltransferase (HAT) activity that modifies the chromatin structure from an inactive to an active state. This model, called transactivation, upregulates the expression of some genes related to glucose, protein, and fat metabolism. Gene repression, on the other hand, is accomplished by GR binding to a negative GRE (nGRE) leading to the formation of a chromatin remodeling complex composed by co-repressor factors, such as NCOR1 and SMRT, and histone deacetylases (HDACs), that ultimately turn chromatin less accessible and suppress gene transcription. The gene repression through direct binding events occurs less frequently when compared to gene induction (25, 35, 38).

Another mechanism of GC action is through binding to other transcription factors (tethering). In case of switching off inflammatory genes, GR binds to transcriptional co-activator molecules, such as CREB binding protein with intrinsic HAT activity, and subsequently recruits HDAC2 to reverse histone acetylation, thus resulting in a suppression of the activated inflammatory gene (39). In the same model, GC interacts with other cofactors, such as the STAT family, to induce chromatin modifications resulting in increased gene expression (26).

Furthermore, the transcriptional dynamics of some genes follow a composite manner. In this model, GR, in conjunction with binding to GRE, also interacts with cofactors in order to enhance or reduce gene expression (35).

GCs can also modulate gene expression by influencing the transcription of epigenetic modifiers. An experimental study demonstrated that GC mediated the upregulation of HDAC2 in rats exposed to chronic stress, which in turn decreased the transcription of histone methyltransferase (Ehmt2) that ultimately upregulated the expression of Nedd4. Nedd4 is a ubiquitin ligase, expression of which has been related to cognitive impairment (40). Additionally, GC was found to interact with another epigenetic eraser, namely JMJD3, a histone demethylase, suppressing its transcription in endothelial cells treated with TNFα that led to decreased expression of other genes related to the blood-brain barrier (41).

GCs have the ability to induce (de)methylation changes in DNA, ultimately affecting gene expression. The DNA methylation process triggered by GC involves the family of DNA methyltransferases (DNMT) and ten-eleven translocation (TET) protein (20, 42-44). The DNMT, DNMT1, DNMT3A, and DNMT3B are able to transfer a methyl group to a cytosine residue in DNA, forming 5-methylcytosine (5mC), which negatively impacts gene expression. In contrast, TET protein chemically modifies the 5mC to form 5-hydroxymethylcytosine (5hmC), which ultimately leads to unmethylated cytosine, positively influencing gene expression (45).

Glucocorticoids mainly induce loss of methylation events rather than gain of methylation across the genome (11, 46). The DNA demethylation process can be either active or passive. The active mechanism is linked to the upregulation of TET enzyme expression that follows GC treatment, which was described in retinal and osteocyte cell line model studies (42, 43). The passive demethylation event involves the downregulation (Fig. 2) or dysfunction of DNMT1. DNMT1 is responsible for maintaining the methylation process in dividing cells (45). In case of GC exposure, GC can cause hypomethylation through downregulation in the expression of DNMT1, a process described in the AtT20 corticotroph tumor cell model, or through GC hindering DNMT activity, particularly DNMT1, as demonstrated in the retinal cell (RPE) line (20, 42, 44).

Glucocorticoid-Induced Epigenetic Changes

There are several molecular mechanisms connecting GR activation and epigenetic modifications ultimately affecting gene expression (Fig. 2). As described above, GC uses epigenetic machinery, such as DNA and histone modifying enzymes, to restructure the chromatin in order to induce or silence gene transcription (16, 47).

In an in vitro study using murine AtT20 corticotroph tumor and neuronal cell lines, after chronic GC exposure followed by a recovery period in the absence of GC, the cells retained an “epigenetic memory” with persistence of loss of methylation content in FKBP5 gene but with no increased gene expression at baseline. The functionality of this “epigenetic memory” only became evident in a second exposure to GC, when the cells responded sharply with a more robust expression of FKBP5 gene compared to the cells without previous exposure to GC (44). Another in vitro study, using a human fetal hippocampal cell line, confirmed long-lasting DNA methylation changes induced by GC. The cells were treated for 10 days with dexamethasone, during the proliferative and cell differentiation phases of the cell line, followed by 20 days without any treatment. The second exposure to GC resulted in an enhanced gene expression of a subset of GC-target genes (48). Additionally, using an animal model subjected to chronic stress, a distinct gene expression profile was demonstrated in response to acute GC challenge compared to those without chronic stress history. The proposed mechanism was that chronic stress resulted in GC-induced enduring epigenetic changes in target genes, altering the responsiveness to a subsequent GC exposure (49).

In general, it seems that the majority of differential methylation regions (DMRs) induced by GC are loss of methylation rather than gain of methylation. In an experimental study, an association between hypomethylation and GC exposure was demonstrated in mice previously exposed to high levels of GC. Further analysis demonstrated that the genes linked with DMR were mostly related to metabolism, the immune system, and neurodevelopment (11).

Human studies have also shown that excess of cortisol can induce modifications in DNA methylation. DNA methylation data obtained from whole blood samples from patients with chronic obstructive pulmonary disease (COPD) treated with GC revealed DMR at specific CpG dinucleotides across the genome. These DMR were confirmed by pyrosequencing and annotated to genes, such as SCNN1A, encoding the α subunit of the epithelial sodium channel, GPR97, encoding G protein coupled receptor 97, and LRP3, encoding low-density lipoprotein receptor-related protein 3 (50). Furthermore, it has been proposed that the negative impact of chronic GC exposure on the immune system, which increases the risk of opportunistically infections, may be epigenetically mediated (51). In a clinical study, using whole blood samples, an analysis of genome-wide DNA methylation was performed on patients before and after exposure to GC (51). Long-term GC exposure disrupts, through a persistent modification of the cytosine methylation pattern, the mTORC1 pathway which affects CD4+ T cell biology (51).

Taken together, these data clearly show the interplay between GC signaling and methylation and histone modifications processes suggesting that GC interferes in the epigenetic landscape modulating gene expression. It is possible that most of these GC-induced epigenetic events are dynamic and temporary, while others may persist leading to long-lasting disorders. Further research to provide insight into what makes some events reversible is warranted.

Epigenetic Changes as a Consequence of Long-Term Glucocorticoid Exposure in Cushing Syndrome

The comorbidities associated with CS are associated with increased mortality mainly due to cardiovascular events (52). GC-induced comorbidities in CS may be at least in part epigenetically mediated. Previous study using whole blood methylation profile demonstrated that specific hypomethylated CpG sites induced by GC were associated with Cushing comorbidities, such as hypertension and osteoporosis (46). The study identified a methylator predictor of GC excess which could be used as a biomarker to monitor GC status (46).

The long-term exposure to high cortisol levels may be crucial for the persistence of some morbidities in CS through epigenetic changes. Hypercortisolism-induced persistent changes in visceral adipose tissue gene expression through epigenetic modifications was investigated in a translational study (12). This study combined data from patients with active CS and data from an animal model of CS in active and remitted phase. Interestingly, the study demonstrated long-lasting changes in the transcriptome of adipose tissue that were associated with histone modifications induced by GC. Therefore, these epigenetic fingerprints observed even after the resolution of hypercortisolism may elucidate the mechanism of persistent modifications in gene expression in the visceral adipose tissue (12).

With regard to the persistence of GC-induced DMR, a genome-wide DNA methylation analysis showed a lower average of DNA methylation in patients in remission of CS compared to controls. Interestingly, the most common biologically relevant affected genes were retinoic acid receptors, thyroid hormone receptors, or hormone/nuclear receptors, important genes related to intracellular pathways and regulators of gene expression (9).

In summary, this large body of evidence supports the concept that prolonged GC exposure modulates the epigenetic landscape across the genome by inducing DMR and histone modifications. Some epigenetic modifications are persistent, and this may partially explain the incomplete reversibility of some of CS features following clinical remission.

Glucocorticoid-Target Genes in Cushing Syndrome

A detailed identification and characterization of GC-target genes may shed light in the understanding of the pathophysiology and treatment response in patients with CS. For instance, the GC regulation of pro-opiomelanocortin (POMC) expression as part of the physiologic GC negative feedback may be impaired in Cushing disease (CD), which is an important mechanism for the maintenance of high GC levels (53). Another example is the interaction between GC and clock genes, which may interfere in the loss of the GC circadian rhythm and may contribute to metabolic disorders in CS (54). Furthermore, the suppressive action of GC on drug targets, such as the somatostatin receptor (subtype 2), may influence the efficacy of first-generation somatostatin receptor ligands in normalizing cortisol levels in CD (55). Here we describe how GCs using epigenetic machinery influence the expression of important target genes and their implications in CS.

FKBP5

FK506 binding protein (FKBP5) plays an important role in the regulation of hypothalamic-pituitary-adrenal (HPA) system (56). As part of the GC negative feedback loop, GC binds to hypothalamic and pituitary GR. In the cytoplasm, GR is bound to a multi-protein complex including FKBP5. FKBP5 modulates GR action by decreasing GR binding affinity to GC and by preventing GR translocation from cytoplasm to nucleus (57, 58). In other words, an increase of FKBP5 expression is inversely correlated with GR activity and results in GC resistance leading to an impaired negative feedback regulation in the HPA axis (59).

FKBP5 is a GC-responsive gene; its upregulation by GC is part of an intracellular negative short-feedback loop (60). The mechanism by which GC regulates FKBP5 expression was shown to include inhibition of DNA methylation (44). In a model for CS, mice treated with corticosterone for 4 weeks had a reduced level of DNA methylation of FKBP5 in DNA extracted from whole blood, which was strongly correlated in a negative manner with GC concentration. Interestingly, a negative correlation was also observed between the degree of FKBP5 gene methylation measured at 4 weeks of GC exposure and the percentage of mice visceral fat (61). Accordingly, previous studies have provided compelling evidence of decreased methylation in the FKBP5 gene in patients with active CS compared to healthy control (10, 46). Even in patients with CS in remission, previous data have suggested a small decrease in FKBP5 methylation levels compared to healthy controls (9, 10). In an in vitro study, it was demonstrated that, by decreasing DNMT1 expression, GC is able to reduce FKBP5 methylation levels and, therefore, increase its expression (44).

Likewise, FKBP5 mRNA is also sensitive to GC exposure. A time-dependent increase in blood FKBP5 mRNA after single-dose prednisone administration has been demonstrated in healthy humans (62). Accordingly, patients with ACTH-dependent CS had higher blood FKBP5 mRNA levels compared with healthy controls, and after a successful surgery, FKBP5 mRNA returned to baseline levels (63). Furthermore, in another study, blood FKBP5 mRNA was inversely correlated with FKBP5 promoter methylation and positively correlated with 24-hour urine free cortisol (UFC) levels in patients with CS (46). Taken together, this fine-tuning of FKBP5 DNA methylation and mRNA according to the level of GC suggests that FKBP5 can be used as a biomarker to infer the magnitude of GC exposure.

POMC and Corticotropin-Releasing Hormone

The partial resistance of the corticotroph adenoma to GC negative feedback is a hallmark of CD. Indeed, the lack of this inhibitory effect constitutes a method to diagnose CD, that is, with the dexamethasone suppression test. One of the mechanisms related to the insensitivity to GC can be attributed to GR mutations which are, however, rarely found in corticotrophinomas (64). Another mechanism that was uncovered in corticotroph adenomas is an overexpression of the HSP90 chaperone resulting in reduced affinity of GR to its ligand and consequently GR resistance (53, 65).

In addition, the loss of protein expression of either Brg1, ATPase component of the SWI/SNF chromatin remodeling complex, or HDAC2 has been linked to GC resistance in about 50% of some adenomas (66). The trans-repression process on POMC transcription achieved by GC involves both the histone deacetylation enzyme and Brg1. One mechanism of corticotropin-releasing hormone (CRH)-induced POMC expression is through an orphan nuclear receptor (NR) related to NGFI-B (Nur77). NGFI-B binds to the NurRE sequence in the promoter region of POMC gene and recruits a co-activator to mediate its transcription. In a tethering mechanism, the GR directly interacts with NGFI-B to form a trans-repression complex, which contains the GR itself, Brg1, the nuclear receptor, and HDAC2; the latter being essential to block the gene expression through chromatin remodeling process (53, 66).

In CD, hypercortisolism exerts a negative feedback at CRH secretion from the hypothalamus (67). The mechanism involved in GR-induced suppression of CRH expression is through direct binding to a nGRE in the promoter region of CRH gene and subsequent recruitment of repressor complexes. In a rat hypothalamic cell line, it was demonstrated that Dex-induced CRH repression occurs through coordinated actions of corepressors involving Methyl-CpG-binding protein 2 (MeCP2), HDAC1, and DNA methyltransferase 3B (DNMT3B). Possibly, GR bound to nGRE recruits DNMT3B to the promoter in order to methylate a specific region, subsequently binding MeCP2 on these methylated sites followed by the recruitment of chromatin modify corepressor HDAC1, ultimately resulting in CRH suppression. Another possibility is that 2 independent complexes, one consisting of GR with DNMT3 for the methylation and the other the MeCP2, bound to methylated region, interact with HDAC1 to induce repression (68).

Clock Genes

The clock system and the HPA axis are interconnected regulatory systems. Cortisol circadian rhythm is modulated by the interaction between a central pacemaker, located in the hypothalamic suprachiasmatic nuclei, and the HPA axis (69). At the molecular level, mediators of the clock system and cortisol also communicate with each other, both acting as transcription factors of many genes to influence cellular functions.

In CS, the impact of chronic GC exposure on clock genes expression was recently evaluated using peripheral blood samples from patients with active disease compared with healthy subjects. The circadian rhythm of peripheral clock gene expression (CLOCK, BMAL, PER1-3, and CRY1) was abolished as a result of hypercortisolism, and that may contribute to metabolic disorders observed in Cushing patients (70). Another study, which investigated persistent changes induced by hypercortisolism in visceral adipose tissue, found that the expression of clock genes, such as PER1, remained altered in association with persistent epigenetic changes in both H3K4me3 and H3K27ac induced by hypercortisolism even after the resolution of hypercortisolism (12). This suggests that chronic exposure to GC may induce sustained epigenetic changes that can influence clock genes expression. Nevertheless, further studies are warranted to better elucidate how long-term exposure to GC impacts clock genes expression using the epigenetic machinery.

Glucocorticoid Effects on MicroRNAs

Along with histone modification and DNA methylation, microRNAs (miRNAs) have emerged as an epigenetic mechanism capable of impacting gene expression without changing DNA sequence (15). Interestingly, miRNA expression itself is also under the influence of epigenetic modifications through promoter methylation like any other protein-encoding genes (71).

MicroRNAs are small (about 20-25 nucleotides in length) non-coding RNAs that are important in transcriptional silencing of messenger RNA (mRNA). By partially pairing with mRNA, miRNAs can either induce mRNA degradation or inhibit mRNA translation to protein. MiRNAs regulate the translation of about 50% of the transcriptome, allowing them to play an important role in a wide range of biological functions, such as cell differentiation, proliferation, metabolism, and apoptosis under normal physiological and pathological situations. Some miRNAs can be classified as oncogenes or tumor suppressing genes, and aberrant expression of miRNAs may be implicated in tumor pathogenesis (71-73).

Insight into the regulation of miRNA expression is, therefore, crucial for a better understanding of tumor development and other human diseases, including cardiac, metabolic, and neurological disorders (73, 74). There are different regulatory mechanisms involved in miRNA expression, including transcriptional factors such as GR-GC. GC may modulate miRNA expression through direct binding to GRE in the promoter region of the host gene, as observed in hemopoietic tumor cells (75). In addition to transcriptional activation, in vascular smooth muscle cells, Dex treatment induces downregulation of DNMT1 and DNMT3a protein levels and reduces the methylation of miRNA-29c promoter, resulting in an increased expression of miRNA-29c (76). Interestingly, it was demonstrated that the increased expression of miRNA-29 family (miRNA-29a, -29b, and -29c) associates with metabolic dysfunction, such as obesity and insulin resistance, which pertains to CS (77, 78). With regard to metabolic dysfunction, miRNA-379 expression was shown to be upregulated by GC and its overexpression in the liver resulted in elevated levels of serum triglycerides associated with very low-density lipoprotein (VLDL) fraction in mice (79). In obese patients, the level of hepatic miRNA-379 expression was higher compared to nonobese patients and positively correlated with serum cortisol and triglycerides (79). Hence, GC-responsive miRNA may be, at least in part, a mediator to GC-driven metabolic conditions in CS.

In pathological conditions, such as seen in CS, prolonged exposure to an elevated cortisol level results in a wide range of comorbidities. It can be hypothesized that the chronic and excessive glucocorticoid levels may induce an aberrant miRNA expression that might impact several cellular processes related to bone and cardiometabolic disorders. A recent study addressed the impact of hypercortisolism on bone miRNA of patients with active CD compared to patients with nonfunctional pituitary adenomas. Significant changes in bone miRNA expression levels were observed, suggesting that the disruption of miRNA may be partially responsible for reduced bone formation and osteoblastogenesis (80). Similarly, altered expression levels of selected miRNAs related to endothelial biology in patients with CS may point to a contribution to a high incidence of cardiovascular disorders in Cushing patients (81). Therefore, dysregulated miRNAs as a consequence of high cortisol levels may underpin the development and progression of comorbidities related to CS. To the best of our knowledge, it is currently not clear whether miRNA dysregulation persists after resolution of hypercortisolism, thus contributing to the persistence of some comorbidities. This hypothesis needs to be further investigated.

MicroRNA can also be used as a diagnostic tool in CS. A study was performed to identify circulating miRNA as a biomarker to differentiate patients with CS from patients with suspected CS who had failed diagnostic tests (the control group) (82). It was observed that miRNA182-5p was differentially expressed in the CS cohort compared to the control group; therefore, it may be used as a biomarker (82). However, a large cohort is necessary to validate this finding (82). In corticotroph tumors, downregulation of miRNA 16-1 expression was observed relative to normal pituitary tissue (83). In contrast, the plasma level of miRNA16-5p was found to be significantly higher in CD compared to ectopic Cushing (EAS) and healthy controls (84). This finding suggests that miRNA16-5p may be a biomarker capable to differentiate the 2 forms of ACTH-dependent Cushing (84).

Epidrugs and Glucocorticoid Action in Cushing’s Syndrome

The interest in understanding the epigenetic mechanism of GC action in the context of CS is based on reversibility of epi-marks, such as DNA methylation and histone modifications, using epidrugs (85, 86). The biological characteristics of epigenetic drugs and their target have been extensively explored. Their effectiveness as antitumor drugs have been tested on corticotroph tumors using in vitro studies (87-89). However, a limited number of studies have explored the role of epidrugs as a therapeutic tool in reversing the genomic action of GC in CS, particularly in comorbidities induced by hypercortisolism (90, 91).

The use of histone deacetylase inhibitors (HDACi) may reduce the genomic action of GC (90-92). It has been demonstrated that the use of the HDAC inhibitor valproic acid increases the acetylation level of GR, consequently attenuating the genomic action of GC. In an experimental Cushing model in rats, the use of valproic acid decreased expression of genes related to lipogenesis, gluconeogenesis, and ion regulators in the kidney that ultimately reduces hepatic steatosis, hyperglycemia, and hypertension in ACTH-infused rats (90, 91).

More studies evaluating the effects of epidrugs influencing the GC actions are warranted to further elucidate the underlying mechanisms and to explore potential treatment modalities to reverse long-lasting consequences of chronic corticoid exposure.

Conclusions

In physiologic conditions, GC are secreted in pulses following a circadian rhythm pattern, as opposed to a constant, chronic, and high GC exposure in CS. This pathological pattern may account for numerous devastating effects observed in CS (7). Yet, the expressed genome in response to chronic GC exposure may potentially be abnormal, leading to dysregulation in clock genes, among other effects.

GC levels may return to a normal circadian pattern in response to a successful treatment, but with incomplete reversibility of some CS features, which may in part be explained by epigenetic changes. The epigenetic machinery is used by GC to induce dynamic changes in chromatin to modulate gene expression. (Fig. 2) It seems that most of chromatin modifications are reversible, but some may persist resulting in long-term epigenetic changes. (Table 1)

Table 1.

Evidence of interaction between glucocorticoid and epigenetic machinery

Epigenetic changes/epigenetic enzymes Action
Histone acetylation (HAT)

  • Glucocorticoid receptors (GR) recruit co-regulators, such as CREB binding protein (CBP), which has intrinsic histone acetyltransferase (HAT) activity that modifies the chromatin structure from an inactive to an active state (25, 33, 35).
Histone deacetylation (HDAC)

  • GR recruit histone deacetylases (HDACs) to turn chromatin less accessible and suppress gene transcription (25, 35).

  • The trans-repression process on POMC transcription achieved by glucocorticoids (GC) involves the histone deacetylation enzyme (HDAC2).

  • GC mediates the upregulation of HDAC2 in rats exposed to chronic stress (40).
Histone demethylase (JMJD3)

  • GC suppress transcription of JMJD3 in endothelial cells treated with TNFα (41).
Histone modifications

  • Using ChIP-seq, a study in mice treated for 5 weeks with corticosterone showed higher levels of histone modifications (H3K4me3, H3K27ac) compared to control mice. In mice after a 10-week washout period, persistence of this epigenetic fingerprint was observed, which was associated with long-lasting changes in gene expression (12).
DNA methylation (DNMT3B) and histone deacetylation (HDAC1)

  • GC mediates CRH downregulation through DNMT3B to the promoter in order to methylate a specific region and recruitment of chromatin modify corepressor HDAC (68).
DNA hypomethylation

  • GC induces downregulation of DNMT1 in AtT20 (mouse corticotroph adenoma cell line) (20).

  • GC induces upregulation of TET enzyme expression which was described in retinal and osteocyte cell line model (42, 43).

  • An experimental study in mice previously exposed to high levels of GC showed differentially methylated regions (DMR) induced by GC treatment, of which the majority was loss of the methylation (11).

  • Reduced DNA methylation in FKBP5 gene was found in patients in active disease and also in remission state of Cushing syndrome (CS) as compared to a healthy control group (10).

  • A genome-wide DNA methylation analysis showed a lower average of DNA methylation in patients in remission of CS compared to controls (9).

  • A study using whole blood methylation profile demonstrated an association between cortisol excess and DNA hypomethylation in patients with CS (46).
Open in new tab

Further studies are needed to elucidate how chronic exposure to GC leads to incomplete reversibility of CS morbidities via sustained modulation of the epigenetic machinery and possibly other mechanisms. Subsequent identification of therapeutic targets may offer new perspective for treatments, for example, with epidrugs, aiming to reverse hypercortisolism-related comorbidities.

Funding

The authors received no financial support for this manuscript.

Disclosures

T.P., R.A.F., and L.J.H. have nothing to declare.

Data Availability

Data sharing is not applicable to this article, as no datasets were generated or analyzed during the current study.

From https://academic.oup.com/jcem/advance-article/doi/10.1210/clinem/dgae151/7633538?searchresult=1

Filed under: Cushing's, symptoms | Tagged: , , , , , , | Leave a comment »

Response to Osilodrostat Therapy in Adrenal Cushing’s Syndrome

Posted on April 15, 2024 by MaryO

Authors Stasiak M , Witek P, Adamska-Fita E, Lewiński A

Received 27 December 2023

Accepted for publication 20 March 2024

Published 8 April 2024 Volume 2024:16 Pages 35—42

DOI https://doi.org/10.2147/DHPS.S453105

Checked for plagiarism Yes

Review by Single anonymous peer review

Peer reviewer comments 2

Editor who approved publication: Dr Hemalkumar B Mehta

Magdalena Stasiak,1 Przemysław Witek,2 Emilia Adamska-Fita,1 Andrzej Lewiński1,3

1Department of Endocrinology and Metabolic Diseases, Polish Mother’s Memorial Hospital—Research Institute, Lodz, Poland; 2Department of Internal Medicine, Endocrinology and Diabetes, Medical University of Warsaw; Mazovian Brodnowski Hospital, Warszawa, Poland; 3Department of Endocrinology and Metabolic Diseases, Medical University of Lodz, Lodz, Poland

Correspondence: Magdalena Stasiak, Department of Endocrinology and Metabolic Diseases, Polish Mother’s Memorial Hospital—Research Institute, 281/289 Rzgowska Street, Lodz, 93-338, Poland, Tel +48502049292, Fax +48422711140, Email mstasiak33@gmail.com

Abstract: Cushing’s disease (CD) is the most common cause of endogenous hypercortisolism. Osilodrostat was demonstrated to be efficient in treating CD, and the mean average dose required for CD control was < 11 mg/day. Potential differences in osilodrostat treatment between cortisol-producing adenoma (CPA) and CD have not been reported. The aim of this study was to present two patients with CPA in whom significant differences in the response to therapy compared to CD were found. We demonstrated a case of inverse response of cortisol levels with adrenal tumor progression during the initial dose escalation (Case 1). Simultaneously, severe exaggeration of hypercortisolism symptoms and life-threatening hypokalemia occurred. A further rapid dose increase resulted in the first noticeable cortisol response at a dose of 20 mg/day, and a full response at a dose of 45 mg/day. We also present a case that was initially resistant to therapy (Case 2). The doses required to achieve the first response and the full response were the same as those for Case 1. Our study demonstrated that osilodrostat therapy in patients with CPA may require a different approach than that in CD, with higher doses, faster dose escalation, and a possible initial inverse response or lack of response.

Keywords: osilodrostat, adrenal adenoma, hypercortisolism, ACTH-independent, adverse events, hypokalemia

Introduction

Chronic persistent hypercortisolism is a life-threatening condition that requires effective treatment. Untreated exposure to excessive cortisol secretion leads to severely increased morbidity and mortality due to cardiovascular diseases, thromboembolic events, sepsis, visceral obesity, impairment of glucose metabolism, and dyslipidaea, as well as musculoskeletal disorders, such as myopathy, osteoporosis, and skeletal fractures. Moreover, neuropsychiatric disorders, such as impairment of cognitive function, depression, or mania, as well as impairment of reproductive function can frequently occur.1,2 Cushing’s disease (CD) – a disorder caused by a pituitary adenoma secreting adrenocorticotropic hormone (ACTH) – is the most common cause of hypercortisolism. Cushing’s syndrome (CS) includes all other causes of cortisol excess, including ectopic ACTH production as well as direct cortisol overproduction by adrenal adenoma (cortisol-producing adenoma [CPA]) or adrenocortical carcinoma (ACC). Approximately 10% of hypercortisolism cases result from CPA. The first line therapy is a surgical resection of the tumor, which is the source of hormone excess. However, in many patients surgery is not fully efficient and other therapies are required to reduce cortisol levels. Additionally, due to severe cardiovascular complications and unstable DM, the surgical approach sometimes entails unacceptable risk and it is frequently postponed until cortisol levels are lowered. Pharmacotherapy with steroidogenesis inhibitors reduces cortisol levels and improves the symptoms of hypercortisolism.1,2 As CD is the most common cause of cortisol excess, most studies have focused on the efficacy and safety of novel steroidogenesis inhibitors, including patients with CD only.3–6 This is exactly the case with osilodrostat – a new potent inhibitor of 11β-hydroxylase.3–6 More data are available for metyrapone efficacy and safety in CSA,7 as the drug has been available much longer than osilodrostat. A study by Detomas et al, which reported results of comparison of efficacy of metyrapone and osilodrostat, included 4 patients with adrenal CS, among whom one CPA patient was treated with osilodrostat.8 Osilodrostat is approved in the United States to treat CD in patients in whom pituitary surgery was not curative or is contraindicated.9 In Poland, osilodrostat therapy is available for patients with all kinds of endogenous hypercortisolism not curative with other approaches, within a national program of emergency access to drug technologies.10 Reports on osilodrostat application in CPA are highly valuable as data on potential differences in the treatment regimens between CD and CPA are scarce.

Here, we present two patients with CPA in whom the response and doses of osilodrostat were different from those reported in patients with CD. The main purpose of this study was to demonstrate that the efficacy of osilodrostat in CPA is high, although initial resistance to treatment or even deterioration of hypercortisolism can occur during the application of lower doses of the drug.

Materials and Methods

Study Design and Patients

We retrospectively analyzed medical files of two consecutive patients with CPA treated with osilodrostat. The analysis included medical history, laboratory and imaging results as well as a detailed reports of adverse events.

Laboratory and Imaging Procedures

Serum cortisol and ACTH levels were measured by electrochemiluminescence immunoassay (ECLIA) using a Cobas e601 analyzer (Roche Diagnostics, Indianapolis, IN, USA). UFC excretion was measured by chemiluminescent microparticle immunoassay (CMIA) using an Abbott Architect ci4100 analyzer (Abbott, Abbott Park, IL, USA). Cross-reactivity with 11-deoxycortisol for this method is very low (2.1% according to the manufacturer’s data). Potassium levels were measured by ion-selective electrode potentiometry using a Beckman Coulter DxC 700 AU Chemistry Analyzer (Beckman Coulter, Brea, CA, USA). Computed tomography (CT) imaging was performed using a Philips Ingenuity Core 128 system (Philips, the Netherlands).

Ethics Procedures

Informed consent was obtained from all subjects involved in the study. Written informed consent was obtained from the patients for publication of this paper. The approval of Institutional Ethics Committee was obtained to publish the case details (approval code KB 33/2023).

Presentation of the Cases

Case 1

A 51-year-old female was referred to our department in November 2021 because of CPA, disqualified from surgery because of severe hypertension with a poor response to antihypertensive therapy and uncontrolled DM despite high doses of insulin. Additionally, the patient presented with hyperlipidemia and severe obesity (BMI=50.7 kg/m2), gastritis, depression, and osteoarthritis. On admission, she complained of a tendency to gain weight, fragile skin that bruised easily, difficulty with wound healing, susceptibility to infections, and insomnia. Physical examination revealed a moon face with plethora, a buffalo hump, central obesity with proximal muscle atrophy, and purple abdominal striae.

The CPA diagnosis was initially made two years earlier, but the patient did not qualify for surgery due to a hypertensive crisis. Soon after this episode, the SARS-CoV-2 pandemic began, and the patient was afraid of visiting any medical center because her son had died of COVID-19. Therefore, she was referred to our center for life-threatening hypercortisolism two years later.

At the time of admission, computed tomography (CT) imaging revealed a right adrenal tumor of 34x24x37mm, with a basal density of 21 HU and a contrast washout rate typical for adenomas (83%). The size and CT characteristics were identical as they were two years earlier. High serum cortisol levels, undetectable ACTH concentrations, and a lack of physiological diurnal rhythm of cortisol secretion were observed (Table 1). Urinary free cortisol (UFC) excretion was 310 µg/24 h, with an upper normal limit (UNL) of 176 µg/24 h. No cortisol suppression was achieved in high-dose dexamethasone suppression test (DST) (Table 1). Other adrenal-related hormonal parameters were within normal ranges, with values as follows: DHEA-S 42.68 µg/dl, aldosterone 3.24 ng/mL, and renin 59.14 µIU/mL.

Table 1 Laboratory Results Before Osilodrostat Therapy – Case 1

Due to multiple severe systemic complications, including uncontrolled hypertension, decompensated DM, and cardiac insufficiency, treatment with osilodrostat was introduced for life-saving pre-surgical management. Osilodrostat was started at a dose of 1 mg twice daily and gradually increased to 6 mg per day with actually an inverse response of serum cortisol level. The late-night cortisol level increased from 16 µg/dl to 25 µg/dl. As the full effect of the osilodrostat dose can occur even after a few weeks, the patient was discharged from hospital and instructed to contact her attending doctor immediately if any health deterioration was noticed. In the case of improvement in the patient’s condition, the next hospitalization was planned 3 weeks later. After three weeks of no contact with the patient, she was readmitted to our department with life-threatening escalation of hypercortisolism, severe hypokalemia, and further deterioration of hypertension, DM, cardiac insufficiency, dyspnea, and significant edemas, including facial edema. Treatments of hypertension, cardiac insufficiency, and DM were intensified, as presented in Table 2. Despite active potassium supplementation, life-threatening hypokalemia of 2.1 mmol/l occurred. Previously observed depression was exaggerated with severe anxiety and fear of death. The dose of osilodrostat was increased to 8 mg/day, and after three days of treatment a further elevation of serum cortisol was found, with an increase in UFC up to 9 × UNL (1546.2 µg/24 h). Due to an entirely unexpected inverse cortisol response, CT imaging was performed and revealed progression of the adenoma size to 39 × 36 × 40 mm, with a slight increase in density up to 27 HU as compared to the previous CT scan performed a month earlier (Figure 1).

Table 2 Changes in the Most Important Parameters During Osilodrostat Therapy – Case 1
Figure 1 Progression of the adrenal adenoma size during the initial doses of osilodrostat: (a) CT scan directly before osilodrostat therapy – solid nodule 34x24x37 mm, basal density 21 HU; (b) CT scan during treatment with 8 mg of osilodrostat daily – solid nodule 39x36x40 mm, basal density of 27 HU.

Considering the extremely high risk associated with such a rapid cortisol increase and related complications, decision of fast osilodrostat dose escalation was made. The dose was increased by 5 mg every other day, up to 45 mg per day, and, finally, a gradual decrease in the cortisol level (Table 2) was achieved, with UFC normalization to 168 µg/24 h. During dose escalation, no deterioration in the adverse effects (AEs) of osilodrostat was observed. Conversely, hypokalemia gradually improved despite a simultaneous reduction in potassium supplementation (Table 2). Facial edema decreased and the level of anxiety improved significantly. The course of hypertension severity as well as a summary of the main parameters controlled during treatment and the medications used are presented in Table 2. As soon as the cortisol level normalized, the patient was referred for surgery and underwent right adrenalectomy without any complications. Histopathology results confirmed a benign adenoma of the right adrenal gland (encapsulated, well-circumscribed tumor consisting of lipid-rich cells with small and uniform nuclei, mostly with eosinophilic intracytoplasmic inclusions). After surgery, hydrocortisone replacement therapy was administered. A few days after surgery, blood pressure and glucose levels gradually decreased, and the patient required reduction of antihypertensive and antidiabetic medications. After 22 months of follow-up, the patient’s general condition is good with no signs of recurrence. Antidepressant treatment is no longer required in this patient. Body mass index was significantly reduced to 40 kg/m2. The antihypertensive medication was completely discontinued, and the glucose level is controlled only with metformin. The patient still requires hydrocortisone substitution at a dose of 30 mg/day.

Case 2

A 39-year-old female was referred to our department in November 2022 with a diagnosis of CPA and unstable hypertension, for which surgery was contraindicated. The patient was unsuccessfully treated with triple antihypertensive therapy (telmisartan 40 mg/day, nebivolol 5 mg/day, and lercanidipine 20 mg/day). The patient reported weight gain, muscle weakness, acne, fragile skin that bruised easily, and secondary amenorrhea. Other comorbidities included gastritis, hypercholesterolemia, and osteoporosis. Physical examination revealed typical signs of Cushing’s syndrome, such as abnormal fat distribution, particularly in the abdomen and supraclavicular fossae, proximal muscle atrophy, moon face, and multiple hematomas. A lack of a serum cortisol diurnal rhythm with high late-night serum cortisol and undetectable ACTH levels was found (Table 3). The short DST revealed no cortisol suppression (Table 3), and the UFC result was 725 µg/24 h, which exceeded the UNL more than four times. The serum levels of renin, aldosterone, and 24-h urine fractionated metanephrines were within the normal ranges. Computed tomography imaging revealed a left adrenal gland tumor measuring 25 × 26 × 22 mm, with a basal density of 32 HU and a washout rate typical for adenoma (76%).

Table 3 Laboratory Results Before Osilodrostat Therapy – Case 2

Osilodrostat therapy was administered for preoperative management. The initial daily dose was 2 mg/day, increased gradually by 2 mg every day with no serum cortisol response (late night cortisol levels 15.8–18.5 µg/dl) and no AEs of the drug (Table 4). After the daily dose of osilodrostat reached 10 mg, it was escalated by 5 mg every other day, initially with no serum cortisol reduction. The dose was increased to 45 mg daily (with the lowest detected late-night serum cortisol of 9.6 µg/dl) (Table 4).

Table 4 Changes in the Most Important Parameters During Osilodrostat Therapy – Case 2

After a week of administration of 45 mg daily, UFC normalization was achieved. Despite rapid dose escalation, no AEs were observed during the entire therapy period. Potassium levels were normal without any supplementation (the lowest detected serum potassium level was 3.9 mmol/l; all other results were over 4.0 mmol/l) (Table 4). After UFC normalization, left adrenalectomy was performed without complications. Histopathological examination revealed benign adrenal adenoma. Antihypertensive therapy was reduced only to 2.5 mg of nebivolol daily. The patient’s general condition improved significantly. Currently, hydrocortisone replacement therapy is administered at a dose of 15 mg/day.

Discussion

Osilodrostat is a novel potent steroidogenesis inhibitor whose efficacy and safety have been thoroughly analyzed in clinical trials of patients with CD, the most common cause of endogenous hypercortisolism. No clinical trial of osilodrostat therapy in CPA has been performed, as this disease constitutes only 10% of all cases of endogenous hypercortisolism. Moreover, osilodrostat is not approved by the FDA for hypercortisolism conditions other than CD.9 Therefore, data on potential differences in the treatment regimen are lacking.

During the course of already reported trials in CD, osilodrostat doses were escalated slowly, every 2–3 weeks,3,5,6 with an excellent response to quite low doses of the drug.3–6 In the LINC 2 extension study the median average dose was 10.6 mg/day,5 while in the LINC 3 extension study and the LINC 4 study it was 7.4 mg/day and 6.9 mg/day, respectively.4,6 In most cases, a significant decrease of hypercortisolism was reported with the low doses of osilodrostat (4 or 10 mg/day). Moreover, some patients received 1 mg/day or even 1 mg every other day, with a good response.6 Even in rare cases of CD in whom initial short-term etomidate therapy was given at the beginning of osilodrostat therapy, due to highly severe life-threatening symptoms of hypercortisolism, the final effective dose of osilodrostat was much lower than that in our patients with CPA (25 mg/day vs 45 mg/day) and no increase of cortisol level was observed.11

It should be underlined that many cases of adrenal insufficiency during osilodrostat therapy in patients with CD have been reported,3–6,12,13 and – therefore – low initial dose with slow gradual dose escalation is recommended in patients with CD.1,6,13

In the cases presented here, CPA led to severe hypercortisolism, the complications of which constituted contraindications for surgery. Therefore, osilodrostat therapy was introduced as a presurgical treatment. In Case 1, the therapy was started at low doses according to the approved product characteristics.14 Due to the severity of hypertension, which was uncontrolled despite of active antihypertensive therapy, as well as to unstable DM, the doses were increased faster than recommended. Surprisingly, we immediately observed a gradual increase in hypercortisolism, in both serum cortisol levels and the UFC, with simultaneous burst of complications related to both hypercortisolism itself and 11β-hydroxylase inhibition. Life-threatening episodes of hypertensive crisis responded poorly to standard therapies. Severe exaggeration of cardiac insufficiency could probably be related to these episodes as well as to deep hypokalemia, which occurred despite potassium supplementation. Hypokalemia is a typical complication of treatment with 11β-hydroxylase inhibitors due to the accumulation of adrenal hormone precursors. However, Patient 1 required much higher doses of potassium supplementation, both parenteral and oral, than ever described during osilodrostat therapy.3–6,13 The dose of 20 mg/day of osilodrostat was the first one which led to noticeable cortisol reduction and a decrease in systolic blood pressure (SBP) to below 170 mmHg. Surprisingly, instead of the expected deterioration of hypokalemia, parenteral potassium administration could be stopped with an osilodrostat dose of 20 mg/day and oral supplementation was gradually reduced simultaneously with osilodrostat dose escalation. The reason why such severe hypokalemia occurred with low doses of osilodrostat and did not deteriorate further seems complex. One possible reason is the administration of high doses of potassium-saving antihypertensive drugs such as spironolactone and the angiotensin II receptor antagonist telmisartan. Additionally, one can consider other possible mechanisms, such as downregulation of the receptors of deoxycorticosterone (DOC) or other adrenal hormone precursors. However, this hypothesis requires further research and confirmation. Such an improvement of the potassium level during osilodrostat dose escalation was previously demonstrated in a patient with CD.11 Interestingly, in our Patient 2, no potassium supplementation was required during the whole time of osilodrostat therapy, although the doses were increased intensively up to the finally effective dose, which was the same (45 mg/day) as for Patient 1. In Patient 2, no actual response to doses lower than 20 mg/day was observed. UFC normalization was achieved after a week of administration of 45 mg/day, five weeks from the beginning of therapy. Although UFC normalization is not always required in pre-surgical treatment, clinical symptoms significantly improved in our patients only after the UFC upper normal level was achieved.

The present paper is one of only a few reports focused on osilodrostat therapy in CPA, and the only one presenting a different therapy course as compared to patients with CD. No case of CPA resistance to low doses of osilodrostat has been described. It should be underlined that in our report “low doses” of osilodrostat were higher than the average mean doses of osilodrostat used in clinical trials in patients with CD.3–6 Therefore, they should not generally be considered low but only much lower than those which were effective in our patients. Malik and Ben-Shlomo presented a case of CPA treated with osilodrostat, with an immediate decrease in cortisol level at 4 mg/day and adrenal insufficiency symptoms after dose escalation to 8 mg/day.15 Similar to our two cases, their patient was a middle-aged female with normal results of all other adrenal parameters, such as renin, angiotensin, or metanephrine levels. However, a CT scan was not performed (or presented), while magnetic resonance imaging revealed an indeterminate adrenal gland mass without a typical contrast phase/out-of-phase dropout for adenoma.15 Therefore, different morphology of cortisol-secreting adrenal tumor can potentially be considered a reason of the different response to treatment. Tanaka et al performed a multicenter study on the efficacy and safety of osilodrostat in Japanese patients with non-CD Cushing’s syndrome.16 Five patients with CPA were included in the study, and none of them required osilodrostat doses higher than 10 mg/day to achieve UFC normalization. However, most of the patients presented by Tanaka et al were previously treated with metyrapone,16 whereas both of our patients were treatment-naive. Previous metyrapone therapy may be considered as a potential reason of better response to osilodrostat. This hypothesis was confirmed in the quoted study by Tanaka et al, who demonstrated that at week 12 the median percent changes in the mUFC values were higher in patients previously treated with metyrapone (–98.97%) than in treatment-naive cases (–86.65%).16 Detomas et al performed a comparison of efficacy and safety of osilodrostat and metyrapone, with one CPA patients included in a group treated with osilodrostat, however no data on a dose required for a disease control are available separately for this particular patient.8 To the best of our knowledge, no more CPA cases have been described and therefore no further comparison is available.

Higher doses of osilodrostat were administered to a group of seven patients with hypercortisolism due to adrenocortical carcinoma (ACC) presented by Tabarin et al.17 A full control of hypercortisolism was achieved in one patient for each dose of 4, 8, 10, and 20 mg/day, and in three patients treated with 40 mg/day.17 These patients, however received other therapies including mitotane and chemotherapy, which can significantly modify the response to osilodrostat.

Several authors have reported the phenomenon of a partial or total loss of response to osilodrostat.5,16,17 In such cases, a response to treatment was initially achieved and then lost during treatment with the same dose. A further increase in osilodrostat dose usually resulted in the response resumption.5,16,17 Such a situation could not be suspected in either of our cases.

The presented cases provide a novel insight into modalities of treatment with osilodrostat in patients with CPA and demonstrate for the first time that an inverse cortisol response is possible in CPA cases, especially those with a higher CT density of adrenal adenoma. Such a situation should not be considered a contraindication to dose escalation. Conversely, the dose should be increased more intensively so as to achieve the initial efficacy threshold, which was 20 mg/day in both of our patients. The fully efficient dose that allowed UFC normalization was more than twice as high (45 mg/day in both cases). A similar approach should be applied in patients who do not respond to lower doses, such as Patient 2. The safety of osilodrostat therapy is strictly individual and not dose dependent in patients with CPA. Adverse events, including hypokalemia, severe hypertension, and edema, can be of life-threatening severity or may not occur regardless of the dose. Moreover, AEs of high severity may decrease with osilodrostat dose escalation. Our study demonstrated that osilodrostat is efficient and can be used in patients with CPA as a pre-surgical therapy if surgery is contraindicated due to hypercortisolism complications.

Our study presented two cases of CPA treated with osilodrostat, and a small size of our group is the main limitation of this report. Future research is required to confirm our observations.

Conclusion

In some patients with CPA, the doses of osilodrostat required for disease control can be much higher than those previously reported. Acceleration of the dose increase can be fast, and the risk of overdosing, adrenal insufficiency, and later necessity of dose reduction seem to be much lower than it could be expected. Low initial doses (<20 mg/day in our study) can be entirely ineffective or can even cause exacerbation of hypercortisolism, whereas high doses (45 mg/day in the present study) are efficient in pre-surgery UFC normalization. AEs associated with osilodrostat can be rapid, with severe hypokalemia despite active potassium supplementation, or may not occur even if high doses of osilodrostat are applied. Therefore, close monitoring for potential AEs is necessary.

Acknowledgments

The abstract included some parts of this paper was presented at the European Congress of Endocrinology ECE2023 as a rapid communication. The abstract was published in the Endocrine Abstracts Vol. 90 [https://www.endocrine-abstracts.org/ea/0090/].

Funding

The publication of this report was financially supported by the statutory funds of the Polish Mother’s Memorial Hospital – Research Institute, Lodz, Poland.

Disclosure

Professor Przemysław Witek reports personal fees from Investigator in the clinical trials paid by Novartis and Recordati Rare Diseases, outside the submitted work; lectures fees from Recordati Rare Diseases, Strongbridge, IPSEN. The authors report no other conflicts of interest in this work.

References

1. Fleseriu M, Auchus R, Bancos I, et al. Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol. 2021;9(12):847–875. doi:10.1016/S2213-8587(21)00235-7

2. Pivonello R, Isidori AM, De Martino MC, et al. Complications of Cushing’s syndrome: state of the art. Lancet Diabetes Endocrinol. 2016;4(7):611–629. doi:10.1016/S2213-8587(16)00086-3

3. Pivonello R, Fleseriu M, Newell-Price J, et al. Efficacy and safety of osilodrostat in patients with Cushing’s disease (LINC 3): a multicentre Phase III study with a double-blind, randomised withdrawal phase. Lancet Diabetes Endocrinol. 2020;8(9):48–761. doi:10.1016/S2213-8587(20)30240-0

4. Fleseriu M, Newell-Price J, Pivonello R, et al. Long-term outcomes of osilodrostat in Cushing’s disease: LINC 3 study extension. Eur J Endocrinol. 2022;187(4):531–541. doi:10.1530/EJE-22-0317

5. Fleseriu M, Biller BMK, Bertherat J, et al. Long-term efficacy and safety of osilodrostat in Cushing’s disease: final results from a Phase II study with an optional extension phase (LINC 2). Pituitary. 2022;25(6):959–970. doi:10.1007/s11102-022-01280-6

6. Gadelha M, Bex M, Feelders RA, et al. Randomized trial of osilodrostat for the treatment of Cushing disease. J Clin Endocrinol Metab. 2022;107(7):e2882–e2895. doi:10.1210/clinem/dgac178

7. Daniel E, Aylwin S, Mustafa O, et al. Effectiveness of metyrapone in treating cushing’s syndrome: a retrospective multicenter study in 195 patients. J Clin Endocrinol Metab. 2015;100(11):4146–4154. doi:10.1210/jc.2015-2616

8. Detomas M, Altieri B, Deutschbein T, et al. Metyrapone versus osilodrostat in the short-term therapy of endogenous cushing’s syndrome: results from a single center cohort study. Front Endocrinol. 2022;13:903545. doi:10.3389/fendo.2022.903545

9. U.S. food and drug administration home page. Available from: https://www.fda.gov/news-events/press-announcements/fda-approves-new-treatment-adults-cushings-disease. Accessed March 22, 2023.

10. Agency for health technology assessment and tariff system home page. Available from: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&cad=rja&uact=8&ved=2ahUKEwj6ypGbsfT9AhUMzYsKHTgAD2EQFnoECA8QAQ&url=https%3A%2F%2Fbipold.aotm.gov.pl%2Fassets%2Ffiles%2Fwykaz_tli%2FRAPORTY%2F2020_010.pdf&usg=AOvVaw3P2Q85gwi3JcxKkW3uxfOb. Accessed March 22, 2022.

11. Dzialach L, Sobolewska J, Respondek W, et al. Cushing’s syndrome: a combined treatment with etomidate and osilodrostat in severe life-threatening hypercortisolemia. Hormones. 2022;21(4):735–742. doi:10.1007/s42000-022-00397-4

12. Ekladios C, Khoury J, Mehr S, et al. Osilodrostat-induced adrenal insufficiency in a patient with Cushing’s disease. Clin Case Rep. 2022;10(11):e6607. doi:10.1002/ccr3.6607

13. Fleseriu M, Biller BMK. Treatment of Cushing’s syndrome with osilodrostat: practical applications of recent studies with case examples. Pituitary. 2022;25(6):795–809. doi:10.1007/s11102-022-01268-2

14. Summary of product characteristics. Available from: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwim1_KdsvT9AhVq-ioKHUZKAc4QFnoECA4QAQ&url=https%3A%2F%2Fwww.ema.europa.eu%2Fen%2Fdocuments%2Fproduct-information%2Fisturisa-epar-product-information_pl.pdf&usg=AOvVaw0S8nayCTdqNh1LsEcXVLEu. Accessed March 24, 2023.

15. Malik RB, Ben-Shlomo A. Adrenal cushing’s syndrome treated with preoperative osilodrostat and adrenalectomy. AACE Clin Case Rep. 2022;8(6):267–270. doi:10.1016/j.aace.2022.10.001

16. Tanaka T, Satoh F, Ujihara M, et al. A multicenter, Phase 2 study to evaluate the efficacy and safety of osilodrostat, a new 11β-hydroxylase inhibitor, in Japanese patients with endogenous Cushing’s syndrome other than Cushing’s disease. Endocr J. 2020;67(8):841–852. doi:10.1507/endocrj.EJ19-0617

17. Tabarin A, Haissaguerre M, Lassole H, et al. Efficacy and tolerance of osilodrostat in patients with Cushing’s syndrome due to adrenocortical carcinomas. Eur J Endocrinol. 2022;186(2):K1–K4. doi:10.1530/EJE-21-1008

Creative Commons License © 2024 The Author(s). This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License. By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.

Filed under: adrenal, Cushing's, Treatments | Tagged: , , , , , , | Leave a comment »

Hiding In Plain Sight: Florid Cushing’s Disease Presenting As A Severe Extremity Cellulitis

Posted on April 12, 2024 by MaryO

Abstract

Disclosure: C.M. Godar: None. E.B. Noble: None. N.O. Vietor: None. T.S. Knee: None.

Background: Cushing’s syndrome may rarely present as an emergency known as Florid Cushing’s Syndrome. Patients can exhibit severe hyperglycemia, hypertension, hypokalemia, infections, and hypercoagulability. Cushing’s syndrome is a rare disease, and the constellation of clinical features can be overlooked if clinicians are not aware of the manifestations of hypercortisolism. We present the case of a patient with Cushing’s syndrome that went unrecognized with life-threatening sequelae.

Case presentation: A 52-year-old woman with well-controlled type 2 diabetes and hypertension was admitted to the hospital for severe left lower extremity cellulitis. Prior to hospitalization she had noted rapid weight gain, fatigue, weakness, mental clouding, and moodiness. She was admitted for antibiotics and surgical debridement. The infection persisted despite broad spectrum antibiotics, multiple surgical debridements, and skin grafting. She became bacteremic, and extremity amputation was considered. She additionally developed hypertensive emergency, refractory hypokalemia, and hyperglycemia to 396 mg/dL. Exam was notable for facial plethora, supraclavicular fullness, dorsocervical fat pad, and violaceous abdominal striae. Cushing’s Syndrome was suspected, and labs revealed a significantly elevated random serum cortisol of 60.5mcg/dL (Ref 6.2-19.4), significantly elevated 24H urine cortisol of 2157mcg/24H (Ref 0-50), and ACTH elevated to 81.8pg/mL (Ref 7.2-63.3) that confirmed Cushing’s Disease. MRI sella and octreotide scans did not localize a lesion. Inpatient therapy included multiple antihypertensive agents, insulin drip, aggressive potassium repletion, and initiation of ketoconazole to reduce cortisol levels. Ketoconazole was maximally dosed and she underwent surgical exploration and removal of a small pituitary microadenoma. Following surgery, she developed transient adrenal insufficiency requiring hydrocortisone and she no longer required antihypertensives, insulin, or potassium therapy. Follow up 7 years later has revealed no recurrence of Cushing’s Disease.

Discussion: Cushing’s Syndrome may present with a variety of clinical features and rarely may present as a medical emergency. Delay in diagnosis can lead to Florid Cushing’s Syndrome which carries high risk for morbidity and mortality. This case illustrates the need for clinician awareness of the features of Cushing’s Syndrome: hypertension, hyperglycemia, rapid weight gain, cushingoid exam features, hypokalemia, hirsutism, virilization, infection, and/or hypercoagulable state. Severe hypercortisolism was responsible for this patient’s refractory infection, and if not controlled, she likely would have endured a lower extremity amputation. Rapid detection with elevated random serum and/or urine cortisol and treatment with a cortisol-lowering agent is critical and lifesaving.

Presentation: Thursday, June 15, 2023

This content is only available as a PDF.

Filed under: Cushing's, symptoms | Tagged: , , , , , , , | Leave a comment »

Long-Term Efficacy and Safety of Subcutaneous Pasireotide Alone or In Combination With Cabergoline in Cushing’s Disease

Posted on November 13, 2023 by MaryO

Objective: This study evaluated short- and long-term efficacy and safety of the second-generation somatostatin receptor ligand pasireotide alone or in combination with dopamine agonist cabergoline in patients with Cushing’s disease (CD).

Study design: This is an open-label, multicenter, non-comparative, Phase II study comprising 35-week core phase and an optional extension phase. All patients started with pasireotide, and cabergoline was added if cortisol remained elevated. Eligible patients had active CD, with or without prior surgery, were pasireotide naïve at screening or had discontinued pasireotide for reasons other than safety. Primary endpoint was proportion of patients with a mean urinary free cortisol (mUFC) level not exceeding the upper limit of normal (ULN) at week 35 with missing data imputed using last available post-baseline assessments.

Results: Of 68 patients enrolled, 26 (38.2%) received pasireotide monotherapy and 42 (61.8%) received pasireotide plus cabergoline during the core phase. Thirty-four patients (50.0%; 95% CI 37.6–62.4) achieved the primary endpoint, of whom 17 (50.0%) received pasireotide monotherapy and 17 (50.0%) received combination therapy. Proportion of patients with mUFC control remained stable during the extension phase up to week 99. Treatment with either mono or combination therapy provided sustained improvements in clinical symptoms of hypercortisolism up to week 99. Hyperglycemia and nausea (51.5% each), diarrhea (44.1%) and cholelithiasis (33.8%) were the most frequent adverse events.

Conclusion: Addition of cabergoline in patients with persistently elevated mUFC on maximum tolerated doses of pasireotide is an effective and well-tolerated long-term strategy for enhancing control of hypercortisolism in some CD patients.

Clinical trial registration: https://clinicaltrials.gov/ct2/show/NCT01915303, identifier NCT01915303.

1 Introduction

Cushing’s disease (CD) is a rare condition arising from chronic overproduction of cortisol, secondary to an adrenocorticotropic hormone (ACTH)-secreting pituitary tumor (1). Untreated hypercortisolism results in substantial multisystem morbidity, impaired quality of life (QoL) and premature mortality (1–4).

Pasireotide is a second-generation, multireceptor-targeted somatostatin receptor ligand (SRLs), with affinity for 4 of the 5 known somatostatin receptor subtypes (SSTRs) (5) and is approved for the treatment of patients with CD for whom surgery has failed or is not an option (6). Phase III trials of pasireotide monotherapy have shown sustained biochemical and clinical benefits up to 5 years (6–9). These benefits are also reflected in real-world evidence (10).

Cabergoline, a potent dopamine agonist with high affinity for dopamine type 2 receptors (D2), is commonly used off-label for the treatment of CD (2). Small, retrospective, non-randomized studies have demonstrated long-term urinary free cortisol (UFC) control (24−;60 months) in 23−;40% of patients with CD, especially those with mild hypercortisolism (11–13). A meta-analysis of individual patient data from six observational studies (n=124) reported normalization of mean UFC (mUFC) levels in 34% of patients (14, 15). However, a short prospective study on cabergoline monotherapy showed a limited value in controlling UFC, possibly linked to short duration (16). As most corticotropinomas co­express SSTR5 and D2, combining pasireotide and cabergoline in a stepwise approach could potentially improve efficacy with achieving more rapid biochemical control (17), a premise supported by results from an 80-day pilot study of 17 patients with CD treated with cabergoline- pasireotide combination, and low-dose ketoconazole (in case of lack of complete control with the two-drug combination) (18).

The current study aims to report the efficacy and safety of prolonged treatment with pasireotide alone or in combination with cabergoline from the largest prospective, multicentre study to date of a pituitary-targeting combination treatment regimen in patients with CD (NCT01915303).

2 Materials and methods

2.1 Patients

Adults (≥18 years) with a confirmed diagnosis of CD or de novo CD, if they were not candidates for surgery or refused surgery were enrolled. Cushing’s disease was defined by a mean 24-hour (24h) UFC level greater than the upper limit of normal (ULN, 137.95 nmol/24h), calculated from three 24h samples collected within 2 weeks; a morning plasma ACTH level within or above the normal range; and a confirmed pituitary source of Cushing’s syndrome, determined by MRI confirmation of pituitary adenoma >6mm or inferior petrosal sinus sampling (IPSS) gradient >3 after CRH stimulation (or >2 if IPSS without CRH stimulation) for those patients with a tumor ≤6mm. For patients who had prior pituitary surgery, histopathology confirming an ACTH staining adenoma was considered confirmatory of CD. Key exclusion criteria included optic chiasm compression requiring surgery, poorly controlled diabetes (glycated hemoglobin [HbA1c] >8%) and having risk factors for torsades de pointes (for further details, see the Supplementary Appendix).

2.2 Study design

This was a single-arm, open-label, multicenter, non-comparative, Phase II study. After 4 weeks of screening, patients were treated in a stepwise approach during the core phase. Patients received subcutaneous pasireotide 0.6 mg twice daily (bid) for 8 weeks. Patients with a mUFC level exceeding ULN after 8 weeks received pasireotide 0.9 mg bid for another 8 weeks. If mUFC level remained elevated with pasireotide 0.9 mg bid, oral cabergoline 0.5 mg once daily (qd) was added for 8 weeks and could be increased to 1.0 mg qd for another 8 weeks (Supplementary Figure S1). After 35 weeks of treatment in the core phase, patients could enter the extension phase of the trial. Addition or titration of cabergoline during the extension phase was at the discretion of investigators.

Collection of extension data commenced from week 43, and patients continued their current study treatment up to study end (4 September 2019; date of last patient visit), week 257. Data beyond week 99 are not reported here because of small patient numbers.

2.3 End points and assessments

The primary endpoint of the study was the proportion of patients with mUFC ≤ULN at week 35. Secondary endpoints (reported at 4-week intervals up to week 35 and 8-week intervals from week 43 to the date of the last patient visit) included changes from baseline in mUFC, plasma ACTH, serum cortisol, total cholesterol, and clinical signs (systolic/diastolic blood pressure, body mass index (BMI), weight, waist circumference, facial rubor, hirsutism, striae, supraclavicular and dorsal fat pads) and symptoms (CushingQoL). Treatment escape was defined as an increase in one UFC above the normal range during follow-up of complete responders (14). Cushing Quality of Life Questionnaire (CushingQoL) (19) scores were reported up to week 35 only. Details on the safety assessments are provided in the Supplementary Appendix.

2.4 Statistical analyses

No formal hypothesis testing was performed because of the exploratory design of the study. Efficacy analyses were conducted on full analysis set, i.e., all patients to whom study treatment was assigned. Safety analyses were conducted on all patients who received ≥1 dose of pasireotide per day during the study. For patients with missing mUFC value at week 35, including those who discontinued, the last available assessment was carried forward. Details on the post hoc analyses and sample size estimation is provided in the Supplementary Appendix. Enrolled patients, who were observed for failed inclusion or exclusion criteria during the monitoring visits, were classified under protocol deviation. However, patients with no safety concerns were allowed to continue in the study and included in the full analysis set as intention to treat – assessing the study outcome, while some patients were excluded from the per protocol analysis.

3 Results

3.1 Study population

A total of 68 patients were enrolled in the study. At baseline, 66 (97.1%) patients were pasireotide naïve, while 2 (2.9%) were treated with pasireotide previously with 4 weeks of washout period prior to screening (Table 1). Of 68 patients received treatment during the core phase, 26 (38.2%) received pasireotide monotherapy and 42 (61.8%) received combination therapy. Fifty-two (76.5%) patients completed the 35-week core phase while 16 (23.5%) discontinued (Figure 1). All 68 patients were included in the full analysis set based on the intention to treat (ITT) principle. One of the protocol deviations observed during the study, was inclusion of 3 patients with normal mUFC value at screening visit (baseline) and assigning a treatment. The deviation category for the 3 patients was ‘failed inclusion criteria’ with screening mUFC value ≤ULN (137.95 nmol/24h) or mUFC calculated using ❤ UFC values or 2 out of 3 UFC values ≤ULN. One of these patients (baseline mUFC 37.37 nmol/24h ≤ULN) was discontinued from the study at Week 2 and due to lack of post-baseline mUFC assessment, was classified ‘non-responder’ at Week 35 assessment. The 2nd patient’s baseline mUFC value of 135.20 nmol/24h was close to ULN (137.95 nmol/24h) and was rescreened. Based on the rescreened mUFC value 306.5 nmol/24h, this patient was included in study, and the mUFC at Week 35 was 192.30 nmol/24h (non-responder at Week 35 assessment). For all study assessments, the scheduled screening visit’s first mUFC value (≤ULN) was used as baseline value. The 3rd patient (baseline mUFC value 131.77 nmol/24h) was discontinued from the study at Week 26 and was also observed for non-compliant schedule visit and medication dosages. The mUFC value recorded at Week 26 (88.95 nmol/24h) was ≤ULN and this last observation was carried forward to Week 35. Hence, the patient was classified ‘responder’, leaving one patient included in the study as responder as a protocol deviation.

Table 1
www.frontiersin.orgTable 1 Patient demographics and baseline characteristics.

Figure 1
www.frontiersin.orgFigure 1 Patient disposition. *If the study drugs were locally available at the end of the core phase, patients could switch over to the commercial supply and exit the extension phase. Only in countries where the drug was not locally available were patients given the option to enter the extension phase. Percentage for patients not entering the extension phase was calculated from the total number of patients enrolled in the study.

Twenty-nine (42.6%) patients continued treatment in the extension phase; 10 (34.5%) received pasireotide monotherapy and 19 (65.5%) received combination therapy. Twelve (41.4%) patients completed the extension phase, while 17 (58.6%) discontinued treatment before study end, most commonly for unsatisfactory therapeutic effect (n=8). The most common reason for discontinuation was adverse events (AEs): 5 (17.2%) patients with pasireotide monotherapy and 2 (5.1%) patients with combination therapy.

3.2 Efficacy: biochemical response

Overall, 34/68 (50.0%; 95% CI 37.6–62.4) patients achieved the primary endpoint, of whom 17 (50.0%) were receiving pasireotide monotherapy and 17 (50.0%) were receiving combination therapy. Patients with mild hypercortisolism (mUFC 1.0–<2.0 x ULN) at baseline were more likely to respond to both pasireotide monotherapy and combination therapy (n=15; 22.1%, Figure 2). Seven of 17 patients in the pasireotide monotherapy group met the primary endpoint based on their last available assessment prior to week 35. Even if the 3 patients who had mUFC ≤ULN at baseline were excluded from the primary analysis, 33/65 (50.7%; 95% CI 38.1–63.4) patients would have achieved the primary endpoint. The results are similar to the original analysis (34/68 (50.0%; 95% CI 37.6–62.4) based on the full analysis set.

Figure 2
www.frontiersin.orgFigure 2 Patients achieving mUFC ≤ULN at week 35. †At baseline there were 23 patients with mild, 30 with moderate and 12 with severe hypercortisolism. mUFC, mean urine free cortisol; ULN, upper limit of normal.

For the overall study population (n=68), mUFC rapidly decreased from 501.6 nmol/24h (3.6 x ULN; SD: 488.66 nmol/24h) to 242.1 nmol/24h (1.8 x ULN; SD: 203.47 nmol/24h) at week 4 and mUFC remained below baseline levels up to week 35 (184.8 nmol/24h; 1.3 x ULN; SD:140.13 nmol/24h). For patients who received pasireotide monotherapy (n=26), mUFC( ± SD) decreased from baseline (442.1± 557.13 nmol/24h [n=26]; 3.2 x ULN) to week 35 (136.6 ± 127.77 nmol/24h [n=14]; 1 x ULN) and at the end of the study (111.2 ± 40.39 nmol/24h [n=5]; 0.8 x ULN) using the last-observation-carried-forward (LOCF). For those who did not normalize on pasireotide monotherapy (n=42), mUFC ( ± SD) decreased from baseline, i.e., last observation before starting cabergoline (280.20 ± 129.03 nmol/24h [n=40]; 2.0 x ULN) to week 35 (206.6 ± 141.96 nmol/24h [n=31]; 1.5 x ULN) and at the end of the study (219.60 ± 83.78 nmol/24h [n=7]; 1.6 x ULN) using the LOCF. During the core phase, mean serum cortisol decreased from 738.6 nmol/L (1.3 x ULN) at baseline to 538.2 nmol/L (0.95 x ULN) and ACTH levels from 16.3 pmol/L (2.7 x ULN) to 11.0 pmol/L (1.8 x ULN) at week 35.

During the extension phase, 25 patients had a mUFC assessment; of whom 12 (48%) had a mUFC ≤ULN at the end of the extension phase. During the extension phase, mUFC levels decreased slightly and fluctuated above and below the ULN up to the week 139 (Figure 3A), while mean serum cortisol remained below ULN (404 nmol/L; Figure 3B) and ACTH levels fluctuated from 8.2 pmol/L to 11.5 pmol/L) and remained above the ULN value (Figure 3C).

Figure 3
www.frontiersin.orgFigure 3 Mean actual change over time in (A) mUFC (B) serum cortisol, and (C) ACTH. ACTH, adrenocorticotropic hormone; mUFC, mean urine free cortisol; ULN, upper limit of normal .

Twenty-one of 38 (55%) patients achieved control with combination therapy at some point during the core or extension study, of whom 13 (62%) experienced escape (at least one UFC >ULN after previous control). The time to achieve control after starting cabergoline ranged from 14−;343 days. Notably, one patient received pasireotide 0.6 mg bid initially, dose increased to 0.9 mg bid at Week 17, followed by addition of cabergoline 0.5 mg od at Week 31. The patient achieved biochemical control (mUFC value of 120.15 nmol/24h) on the same day of the start of combination therapy. Clinically it is highly unlikely that biochemical control was achieved with single dose of cabergoline administration. Therefore, it could be considered that normalization was achieved while receiving pasireotide monotherapy. Also, the physician might have prescribed combination therapy before receiving the mUFC value of the (urinary) sample delivered on the morning of combination therapy initiation (while the patient was still on monotherapy). The patient continued combination therapy and maintained biochemical control up to Week 35 and beyond. Furthermore, at Week 59 the cabergoline dose was increased to 1.0 mg/day due to mUFC >ULN at previous visit (Week 51). The patient remained on pasireotide 0.9 mg bid/cabergoline 1.0 mg od combination therapy until the study end.

The median time to escape after achieving control with the addition of cabergoline was 58 days (range 28−;344). 10/13patients regained biochemical control with combination therapy. No patients on pasireotide alone experienced escape, probably due to the short observation time.

3.3 Clinical signs and symptoms of CD

Relative to baseline, pasireotide monotherapy was accompanied by reductions in median blood pressure, weight, BMI, waist circumference, and total cholesterol. Overall improvement in clinical measures persisted over time (Supplementary Table S1). Clinical improvements were also seen following the addition of cabergoline, particularly for hirsutism (Supplementary Figures S2, S3).

Mean( ± SD) standardized CushingQoL score was 41.6(± 20.2) at baseline and increased to 47.6(± 20.8) at week 35 (Supplementary Table S2), indicating improvements in patients’ QoL (19).

3.4 Safety and tolerability

Median duration of exposure to pasireotide was 35.0 weeks (range 0−;268), with a median dose of 1.53 mg/day (range 0.29−;1.80). Median duration of exposure to cabergoline was 16.9 weeks (range 1−;215), with a median dose of 0.50 mg/day (range 0.44−;0.97).

All patients (N=68) reported at least one AE and 28/68 (41.2%) patients had a grade 3/4 AE (Table 2). The most common AEs (≥30%) were hyperglycemia and nausea (51.5% each), diarrhea (44.1%) and cholelithiasis (33.8%). Treatment-related AEs (TRAEs) were reported in 66/68 (97.1%) patients; the most frequent TRAEs (≥30%) were hyperglycemia and nausea (47.1% each), diarrhea (39.7%), and cholelithiasis (32.4%). Fourteen (20.6%) patients had ≥1 AE leading to discontinuation.

Table 2
www.frontiersin.orgTable 2 Summary of adverse events (≥10%), overall and by treatment regimen.

The most common AEs leading to discontinuation were increased gamma-glutamyl transferase (GGT) and hyperglycemia (two patients each, 2.9%). Twenty-three (33.8%) patients had ≥1 AE leading to dose adjustment or interruption. Details on special safety assessments such as hyperglycemia-related AEs, blood glucose, HbA1c, IGF-1 as well as hematological and biochemical abnormalities are presented in the Supplementary Appendix.

Three (4.4%) patients died during the study, two (2.9%) during the core phase and one (1.5%) during the extension. All deaths were considered unrelated to study medication. The causes during the core phase were multi-organ dysfunction syndrome for one patient aged 79 years and unknown for the other aged 34 years. Uncontrolled hypertension was reported as the cause of death for the patient aged 47 during the extension phase.

4 Discussion

The severe morbidity and increased mortality with uncontrolled CD highlight the importance of identifying an effective medical strategy. This study explored the potential of a synergistic benefit of the addition of cabergoline to pasireotide treatment in patients with CD.

Complete normalization of cortisol production is required to reverse the risks of morbidity and mortality in patients with CD (1). Two small studies showed clinical improvement of normalized UFC when cabergoline and ketoconazole were combined (20, 21). Benefit has also been reported with triple therapy with pasireotide, cabergoline and ketoconazole (18) and triple therapy with ketoconazole, metyrapone and mitotane in severe CD (22). In the current study, 50% of patients achieved the primary endpoint of mUFC ≤ULN at week 35 and a similar proportion (48%) sustained biochemical control throughout the extension phase. Notably, combination treatment doubled the number of patients who attained mUFC ≤ULN from the core phase to the end of the extension phase. In particular, mUFC was rapidly reduced with treatment, i.e., in most patients within 2 months, while measures of patient-reported outcomes also improved including QoL. Twenty-three patients (33.8%) who completed the core phase did not enter the extension phase. This was because only patients from countries where a commercial supply was unavailable were given the option to enter the extension phase.

This study confirms previous reports that patients with mild hypercortisolism at baseline were more likely to achieve mUFC control with pasireotide monotherapy than patients with moderate or severe hypercortisolism (6, 23). In addition, patients with moderate hypercortisolism at baseline were more likely to achieve mUFC control with the addition of cabergoline. This supports that a combination therapy can be effective for patients with a wider range of disease severity. Accordingly, in vitro data may indeed indicate synergism between SSTR and D2 that might increase therapeutic efficacy (24, 25).

Improvements in clinical signs and symptoms with pasireotide monotherapy were consistent with published data (6, 10). In the core phase, an improvement of blood pressure and BMI was observed with pasireotide monotherapy and, to a lesser extent, with combination therapy which may related to the difference in duration of biochemical remission.

The overall safety profile was consistent with that expected for pasireotide, with most AEs being mild/moderate (26, 27). There were no new safety signals identified with the addition of cabergoline. Common AEs including nausea, headache, dizziness, and fatigue are suggestive of steroid withdrawal symptoms associated with the decrease in UFC, although direct drug effects cannot fully be excluded. Adrenal insufficiency was not reported as side effect. Rates of hyperglycemia-related AEs (68%) were consistent with those in previous reports of pasireotide monotherapy (6, 10). FPG increased with pasireotide monotherapy during the first 8 weeks of treatment and stabilized for the remainder of the study, including following the addition of cabergoline. These data highlight the vital role of blood glucose monitoring in these patients.

Both pasireotide and cabergoline are pituitary-targeted agents that act directly on the source of the disease via inhibition of ACTH release by the corticotroph tumor, which may be an advantage over steroid synthesis inhibitors. This study further confirms previous data reporting the benefits of pasireotide in combination with cabergoline in patients with CD (18). While not entirely elucidated, down-regulation of dopamine D2 receptors (D2R) expression, and post-receptor desensitization and/or tumor regrowth of corticotroph tumor cell were suggested as possible mechanisms for treatment escape (15). Moreover, different dopamine receptor patterns and/or D2R isoforms also influence the response and eventually the treatment escape. Treatment escape has been observed in some studies after long-term (7−;12 months) treatment with cabergoline (13), however it is possible that use of concomitant SRLs could potentially reduce the rate of escape. In this study, a total of 13 patients experienced treatment escape. However, 10 of these patients regained biochemical control. For 7 of these 10 patients, there was up titration of doses to a maximum of 1.8 mg/day of pasireotide and 1 mg/day of cabergolineAlthough pasireotide and cabergoline have shown long-term reduction in IGF-1 levels in patients with acromegaly (28, 29), there is little evidence for this effect in patients with CD (4, 30). One study (n=17) found significant decreases in IGF-1 after 28 days’ treatment with pasireotide that was independent of UFC reduction. One-third of patients had low IGF-1 (30). Our study showed that almost half of patients (47.6%) had IGF-1 levels either above ULN or below LLN prior to the addition of cabergoline, and IGF-1 levels decreased relative to the baseline, with majority of values within the normal range during the core and extension phases up to week 99. Baseline levels of IGF-1 may already be low because of the suppressive effect of excess cortisol on the somatotropic axis (31).

Although clinicians have several therapeutic options at their disposal to treat hypercortisolemia associated with CD, the optimal treatment approach should be based on the individual clinical situation and the benefit–risk considerations for each patient. In this study, 13 patients had history of pituitary radiation, with a duration of at least 2.6 years (median 3.3 years) between the last radiation treatment and the observed response date. However, only 7/13 patients achieved the therapeutic target. Although there was a gap of > 2 years, we cannot exclude the role of radiation in normalizing UFC. Contrastingly, 6/13 patients treated with radiation did not achieve mUFC ≤ULN (responders) at Week 35. The impact of the adjuvant radiation therapy remains unclear.

The strengths of this study are that this is the largest and longest prospective study with pituitary-directed pharmacotherapy, to date, evaluating the addition of cabergoline to pasireotide in patients with CD, and this stepwise approach reflects real-world clinical practice (18). The study is limited by the open-label design and the fact that it was not a head-to-head comparative study of pasireotide only versus pasireotide plus cabergoline. This may be of importance in interpreting patient-reported outcomes. Several patients continued treatment for almost 2 years; however, interpretation of long-term data should be made with caution because of the small patient numbers. Notably, the last available assessment was carried forward for patients with missing mUFC value at week 35 including those who discontinued and were considered for response analysis. It should also be noted that the definition of loss of response, also known as escape, used in this study (at least one UFC value >ULN after previously achieving UFC ≤ULN) may overestimate the rate of apparent escape as UFC values may have fluctuated about the ULN range or been marginally elevated. The definition of treatment escape differs across studies, and we have used a very stringent one in this study, requiring only a single high UFC to meet the classification as escape. Thus, it is likely that some loss of biochemical control interpreted as escape is actually fluctuation of cortisol around the upper limit of normal range.

Other limitations include protocol deviations in including 3 patients with normal UFC at baseline (one patient was uncontrolled at rescreen, and one was discontinued at 2 weeks – both classified as

non-responders), lack of data on impact of radiation therapy without study drug in patients who gained biochemical control with adjuvant radiation therapy, lack of pituitary magnetic resonance imaging to detect pituitary tumor changes, lack of data about effective cabergoline dose and absence of cardiac valve assessment for mild to moderate severity in the medium term. Both pasireotide and cabergoline can induce tumor shrinkage in CD (6, 9, 32–35) and it would be interesting to examine the combined effect on tumor size. This study used the subcutaneous formulation of pasireotide, whereas the most common usage currently is the long-acting formulation. Efficacy of long-acting pasireotide (36) seems higher compared to the subcutaneous formulation (7) and the effect of combination of long-acting pasireotide with cabergoline should be evaluated in future studies. No formal assessments were made for impulsive control disorders, which have been associated with dopamine agonists, including cabergoline (32, 33, 37, 38). The reason that several different terms were used for hyperglycemia-related AEs is that they were reported as per discretion of each investigator. No additional psychiatric AEs were reported, although they were not exhaustively searched.

5 Conclusions

This is the first study demonstrating that pituitary-targeted combination treatment with pasireotide and cabergoline doubled the number of patients who attained mUFC ≤ULN. Both short- and long-term safety profile are consistent with known data for pasireotide and cabergoline. The low rate of discontinuation due to AEs suggests that pasireotide alone or as combination treatment is generally well-tolerated if appropriately monitored, even with prolonged treatment. The addition of cabergoline to pasireotide treatment in patients with persistently elevated mUFC could be an effective long-term strategy for enhancing the control of CD in a subset of patients, with close monitoring for possible escape.

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Ethics statement

The studies involving humans were approved by Hospital Britanico, Buenos Aires, Argentina; Ethische commissie University Hospitals Leuven, Leuven, Belgium; Universitair Ziekenhuis Gent, Gent, Belgium; Comite de Etica em Pesquisa Hospital Moinhos de Vento, Porto Alegre-RS, Brazil; Comitê de Ética em Pesquisa do Hospital de Clı́nicas, Universidade Federal do Paraná, Curitiba-PR, Brazil; Comissão de Ética para Análise de Projetos de Pesquisa, São Paulo – SP, Brazil; Ethics Committee for clinical trials, Sofia, Bulgaria; Comité Corporativo de Ética en Investigación, Bogotá DC, Colombia; Comite De Protection Des Personnes, Groupe Hospitalier Pellegrin – Bat, Bordeaux Cedex, France; Friedrich-Alexander Universitat Erlangen-Nurnberg, Medizinische Fakultat, Erlangen, Germany;National Ethics Committee, Cholargos, Athens, Greece; Ethics Committee for Clinical Pharmacology (ECCP), Budapest, Hungary; Institute Ethics Committee, New Delhi, India; Institutional Review Board (IRB) Ethics Committee Silver, Christian Medical College, Vellore, Tamil Nadu, India; Institute Ethics Committee, PGIMER, Chandigarh, India; Comitato Etico Dell’irccs Istituto Auxologico Italiano Di Milano, Milano, Italy; Comitato Etico Universita’ Federico Ii Di Napoli, Napoli, Italy; Jawatankuasa Etika & Penyelidikan Perubatan (Medical Research and Ethics Committee), d/a Institut Pengurusan Keshatan Jalan Rumah Sakit, Kuala Lumpur, Malaysia; Institutd Nacional De Neurologia Y Neurocirugia, Mexico City, Mexico; Clinica Bajio (CLINBA), Guanajuato, Mexico; Medische Ethische Toetsings Commissie, Rotterdam; Netherlands; CEIm Provincial de Málaga, Málaga, Spain; Istanbul University Cerrahpasa Medical Faculty, Istanbul, Turkey; WIRB, Puyallup, WA, USA; Research Integrity Office, Oregon Health & Science University Portland, OR USA. The studies were conducted in accordance with local legislations and institutional requirements. The participants provided their written informed consent to participate in this study.

Author contributions

All authors directly participated in the planning, execution, or analysis, and have had full control of complete primary data, and hold responsibility for data integrity and accuracy. All authors contributed to the article and approved the submitted version.

Acknowledgments

We thank Julie Brown, Mudskipper Business Ltd, and Manojkumar Patel and Sashi Kiran Goteti, Novartis Healthcare Private Limited, for medical editorial assistance with this manuscript. We would also like to thank all investigators, sub-investigators, study nurses and coordinators, and patients who have made this study possible.

Conflict of interest

HP and RM were Novartis employees and owned Novartis stocks. AMP was employed by Novartis and Recordati. AC is a Novartis employee and owns Novartis stocks. RF received research grants from Strongbridge and Corcept, consulting fee from Recordati, honoraria and financial support for meetings and/or travel from HRA Pharma and Recordati, and attended advisory boards for Recordati. MF has received research support to Oregon Health & Science University as a principal investigator from Recordati and Xeris Strongbridge and has performed occasional scientific consultancy for Recordati, HRA Pharma, Sparrow, and Xeris Strongbridge. PK attended advisory boards for Recordati. MB’s institution received consulting fee and attended advisory boards from Recordati. DG-D received research grants from Recordati Rare Disease and Bayer, consulting fee from Abbott-Lafrancol, Biotoscana, PTC lab, Glaxo/Helou, Recordati Rare Disease, and Bayer, honoraria from Valentech Pharma, Sanofi, and Bayer, travel grants from Recordati Rare Disease, advocacy groups and other leadership roles from Asociación Colombiana de Endocrinologia and Asociación Colombiana de Osteoporosis y Metabolismo, and other financial and non-financial interests include Asociacion Colombiana de Endocrinologia y Metabolismo, Hospital Universitario Fundación Santa Fé de Bogota, and Asociación Colombiana de Osteoporosis y Metabolismo. CB received research grants from Novartis and Recordati, and consulting and speaker fee from Novartis. BB served as the principal investigator for grants to Massachusetts General Hospital from Cortendo/Strongbridge Xeris, Millendo, and Novartis and has occasionally consulted for Cortendo/Strongbridge Xeris, HRA Pharma, Novartis Recordati, and Sparrow. RP and his institution received research grants and honoraria from Pfizer, Ipsen, Novartis, Merck Serono, IBSA Farmaceutici, Corcept, Shire, HRA Pharma, ICON, Covance, Neuroendocrine CAH, Camurus, Recordati, Janssen Cilag, and CMED Clinical Services, received consulting fee from Recordati Rare Disease, Organon Italia, Siunergos Pharma, Corcept, S&R Farmaceutici S.p.A., DAMOR Farmaceutici, and Pfizer, attended advisory boards from Crinetics Pharmaceuticals, Recordati Rare Disease, Pfizer, and HRA Pharma.

The remaining author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The authors declare that this study received funding from Novartis Pharma AG. Novartis was involved in the study design, analysis, interpretation of data, and providing financial support for medical editorial assistance of this article.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fendo.2023.1165681/full#supplementary-material

References

1. Lacroix A, Feelders RA, Stratakis CA, Nieman LK. Cushing’s syndrome. Lancet (2015) 386(9996):913–27. doi: 10.1016/s0140-6736(14)61375-1

PubMed Abstract | CrossRef Full Text | Google Scholar

2. Feelders RA, Newell-Price J, Pivonello R, Nieman LK, Hofland LJ, Lacroix A. Advances in the medical treatment of Cushing’s syndrome. Lancet Diabetes Endocrinol (2019) 7(4):300–12. doi: 10.1016/s2213-8587(18)30155-4

PubMed Abstract | CrossRef Full Text | Google Scholar

3. Newell-Price J. Mortality in cushing disease. Nat Rev Endocrinol (2016) 12(9):502–3. doi: 10.1038/nrendo.2016.118

PubMed Abstract | CrossRef Full Text | Google Scholar

4. Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR, et al. Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol (2021) 9(12):847–75. doi: 10.1016/s2213-8587(21)00235-7

PubMed Abstract | CrossRef Full Text | Google Scholar

5. Schmid HA. Pasireotide (SOM230): Development, mechanism of action and potential applications. Mol Cell Endocrinol (2008) 286(1):69–74. doi: 10.1016/j.mce.2007.09.006

PubMed Abstract | CrossRef Full Text | Google Scholar

6. Colao A, Petersenn S, Newell-Price J, Findling JW, Gu F, Maldonado M, et al. A 12-month Phase 3 study of pasireotide in Cushing’s disease. N Engl J Med (2012) 366(10):914–24. doi: 10.1056/NEJMoa1105743

PubMed Abstract | CrossRef Full Text | Google Scholar

7. Lacroix A, Gu F, Gallardo W, Pivonello R, Yu Y, Witek P, et al. Efficacy and safety of once-monthly pasireotide in Cushing’s disease: a 12 month clinical trial. Lancet Diabetes Endocrinol (2018) 6(1):17–26. doi: 10.1016/s2213-8587(17)30326-1

PubMed Abstract | CrossRef Full Text | Google Scholar

8. Fleseriu M, Petersenn S, Biller BMK, Kadioglu P, De Block C, T’Sjoen G, et al. Long-term efficacy and safety of once-monthly pasireotide in Cushing’s disease: A Phase III extension study. Clin Endocrinol (2019) 91(6):776–85. doi: 10.1111/cen.14081

CrossRef Full Text | Google Scholar

9. Petersenn S, Salgado LR, Schopohl J, Portocarrero-Ortiz L, Arnaldi G, Lacroix A, et al. Long-term treatment of Cushing’s disease with pasireotide: 5-year results from an open-label extension study of a Phase III trial. Endocrine (2017) 57(1):156–65. doi: 10.1007/s12020-017-1316-3

PubMed Abstract | CrossRef Full Text | Google Scholar

10. Fleseriu M, Iweha C, Salgado L, Mazzuco TL, Campigotto F, Maamari R, et al. Safety and efficacy of subcutaneous pasireotide in patients with Cushing’s disease: results from an open-label, multicenter, single-arm, multinational, expanded-access study. Original Res Front Endocrinol (Lausanne) (2019) 10:436. doi: 10.3389/fendo.2019.00436

CrossRef Full Text | Google Scholar

11. Pivonello R, De Martino MC, Cappabianca P, De Leo M, Faggiano A, Lombardi G, et al. The medical treatment of Cushing’s disease: effectiveness of chronic treatment with the dopamine agonist cabergoline in patients unsuccessfully treated by surgery. J Clin Endocrinol Metab (2009) 94(1):223–30. doi: 10.1210/jc.2008-1533

PubMed Abstract | CrossRef Full Text | Google Scholar

12. Godbout A, Manavela M, Danilowicz K, Beauregard H, Bruno OD, Lacroix A. Cabergoline monotherapy in the long-term treatment of Cushing’s disease. Eur J Endocrinol (2010) 163(5):709–16. doi: 10.1530/eje-10-0382

PubMed Abstract | CrossRef Full Text | Google Scholar

13. Ferriere A, Cortet C, Chanson P, Delemer B, Caron P, Chabre O, et al. Cabergoline for Cushing’s disease: a large retrospective multicenter study. Eur J Endocrinol (2017) 176(3):305–14. doi: 10.1530/eje-16-0662

PubMed Abstract | CrossRef Full Text | Google Scholar

14. Palui R, Sahoo J, Kamalanathan S, Kar SS, Selvarajan S, Durgia H. Effect of cabergoline monotherapy in Cushing’s disease: an individual participant data meta-analysis. J Endocrinol Invest (2018) 41(12):1445–55. doi: 10.1007/s40618-018-0936-7

PubMed Abstract | CrossRef Full Text | Google Scholar

15. Palui R, Sahoo J, Kamalanathan S, Kar SS, Selvarajan S, Durgia H. Correction to: Palui R, Sahoo J, Kamalanathan S, Kar SS, Selvarajan S, Durgia H. Effect of cabergoline monotherapy in Cushing’ disease: an individual participant data meta-analysis. J Endocrinol Invest. 2018; 41(12):1445-1455. Doi: 10.1007/s40618-018-0936-7. J Endocrinol Invest (2022) 45(4):899–900. doi: 10.1007/s40618-021-01723-0

PubMed Abstract | CrossRef Full Text | Google Scholar

16. Burman P, Edén-Engström B, Ekman B, Karlsson FA, Schwarcz E, Wahlberg J. Limited value of cabergoline in Cushing’s disease: a prospective study of a 6-week treatment in 20 patients. Eur J Endocrinol (2016) 174(1):17–24. doi: 10.1530/eje-15-0807

PubMed Abstract | CrossRef Full Text | Google Scholar

17. Colao A, Filippella M, Pivonello R, Di Somma C, Faggiano A, Lombardi G. Combined therapy of somatostatin analogues and dopamine agonists in the treatment of pituitary tumours. Eur J Endocrinol (2007) 156:S57–63. doi: 10.1530/eje.1.02348

PubMed Abstract | CrossRef Full Text | Google Scholar

18. Feelders RA, de Bruin C, Pereira AM, Romijn JA, Netea-Maier RT, Hermus AR, et al. Pasireotide alone or with cabergoline and ketoconazole in Cushing’s disease. N Engl J Med (2010) 362(19):1846–8. doi: 10.1056/NEJMc1000094

PubMed Abstract | CrossRef Full Text | Google Scholar

19. Webb SM, Badia X, Barahona MJ, Colao A, Strasburger CJ, Tabarin A, et al. Evaluation of health-related quality of life in patients with Cushing’s syndrome with a new questionnaire. Eur J Endocrinol (2008) 158(5):623–30. doi: 10.1530/eje-07-0762

PubMed Abstract | CrossRef Full Text | Google Scholar

20. Barbot M, Albiger N, Ceccato F, Zilio M, Frigo AC, Denaro L, et al. Combination therapy for Cushing’s disease: effectiveness of two schedules of treatment: should we start with cabergoline or ketoconazole? . Pituitary (2014) 17(2):109–17. doi: 10.1007/s11102-013-0475-3

PubMed Abstract | CrossRef Full Text | Google Scholar

21. Vilar L, Naves LA, Azevedo MF, Arruda MJ, Arahata CM, Moura E, et al. Effectiveness of cabergoline in monotherapy and combined with ketoconazole in the management of Cushing’s disease. Pituitary (2010) 13(2):123–9. doi: 10.1007/s11102-009-0209-8

PubMed Abstract | CrossRef Full Text | Google Scholar

22. Kamenický P, Droumaguet C, Salenave S, Blanchard A, Jublanc C, Gautier JF, et al. Mitotane, metyrapone, and ketoconazole combination therapy as an alternative to rescue adrenalectomy for severe ACTH-dependent Cushing’s syndrome. J Clin Endocrinol Metab. (2011) 96(9):2796–804. doi: 10.1210/jc.2011-0536

PubMed Abstract | CrossRef Full Text | Google Scholar

23. Boscaro M, Ludlam WH, Atkinson B, Glusman JE, Petersenn S, Reincke M, et al. Treatment of pituitary-dependent Cushing’s disease with the multireceptor ligand somatostatin analog pasireotide (SOM230): a multicenter, Phase II trial. J Clin Endocrinol Metab (2009) 94(1):115–22. doi: 10.1210/jc.2008-1008

PubMed Abstract | CrossRef Full Text | Google Scholar

24. Rocheville M, Lange DC, Kumar U, Patel SC, Patel RC, Patel YC. Receptors for dopamine and somatostatin: formation of hetero-oligomers with enhanced functional activity. Science (2000) 288(5463):154–7. doi: 10.1126/science.288.5463.154

PubMed Abstract | CrossRef Full Text | Google Scholar

25. Baragli A, Alturaihi H, Watt HL, Abdallah A, Kumar U. Heterooligomerization of human dopamine receptor 2 and somatostatin receptor 2 Co-immunoprecipitation and fluorescence resonance energy transfer analysis. Cell Signal (2007) 19(11):2304–16. doi: 10.1016/j.cellsig.2007.07.007

PubMed Abstract | CrossRef Full Text | Google Scholar

26. Pivonello R, Ferrigno R, De Martino MC, Simeoli C, Di Paola N, Pivonello C, et al. Medical treatment of Cushing’s disease: an overview of the current and recent clinical trials. Front Endocrinol (Lausanne) (2020) 11:648. doi: 10.3389/fendo.2020.00648

CrossRef Full Text | Google Scholar

27. Capatina C, Hinojosa-Amaya JM, Poiana C, Fleseriu M. Management of patients with persistent or recurrent Cushing’s disease after initial pituitary surgery. Expert Rev Endocrinol Metab (2020) 15(5):321–39. doi: 10.1080/17446651.2020.1802243

PubMed Abstract | CrossRef Full Text | Google Scholar

28. Colao A, Bronstein MD, Brue T, De Marinis L, Fleseriu M, Guitelman M, et al. Pasireotide for acromegaly: long-term outcomes from an extension to the Phase III PAOLA study. Eur J Endocrinol (2020) 182(6):583. doi: 10.1530/EJE-19-0762

PubMed Abstract | CrossRef Full Text | Google Scholar

29. Marazuela M, Ramos-Leví A, Sampedro-Núñez M, Bernabeu I. Cabergoline treatment in acromegaly: pros. Endocrine (2014) 46(2):215–9. doi: 10.1007/s12020-014-0206-1

PubMed Abstract | CrossRef Full Text | Google Scholar

30. Varewijck AJ, Feelders RA, de Bruin C, Pereira AM, Netea-Maier RT, Zelissen PMJ, et al. P3-535, Pasireotide treatment in cushing disease: effects on the IGF-I system. Endocr Rev (2011) 32(Suppl 1):1–3095. doi: 10.1210/endo-meetings.2011.PART4.P5.P3-535

CrossRef Full Text | Google Scholar

31. Mazziotti G, Giustina A. Glucocorticoids and the regulation of growth hormone secretion. Nat Rev Endocrinol (2013) 9(5):265–76. doi: 10.1038/nrendo.2013.5

PubMed Abstract | CrossRef Full Text | Google Scholar

32. Batista RL, Musolino NRC, Cescato VAS, da Silva GO, Medeiros RSS, Herkenhoff CGB, et al. Cabergoline in the management of residual nonfunctioning pituitary adenoma: a single-center, open-label, 2-year randomized clinical trial. Am J Clin Oncol (2019) 42(2):221–7. doi: 10.1097/coc.0000000000000505

PubMed Abstract | CrossRef Full Text | Google Scholar

33. Lacroix A, Gu F, Schopohl J, Kandra A, Pedroncelli AM, Jin L, et al. Pasireotide treatment significantly reduces tumor volume in patients with Cushing’s disease: results from a Phase 3 study. Pituitary (2020) 23(3):203–11. doi: 10.1007/s11102-019-01021-2

PubMed Abstract | CrossRef Full Text | Google Scholar

34. Simeoli C, Auriemma RS, Tortora F, De Leo M, Iacuaniello D, Cozzolino A, et al. The treatment with pasireotide in Cushing’s disease: effects of long-term treatment on tumor mass in the experience of a single center. Endocrine (2015) 50(3):725–40. doi: 10.1007/s12020-015-0557-2

PubMed Abstract | CrossRef Full Text | Google Scholar

35. Manavela MP, Danilowicz K, Bruno OD. Macrocorticotropinoma shrinkage and control of hypercortisolism under long-term cabergoline therapy: case report. Pituitary (2012) 15:33–6. doi: 10.1007/s11102-011-0309-0

PubMed Abstract | CrossRef Full Text | Google Scholar

36. Lacroix A, Bronstein MD, Schopohl J, Delibasi T, Salvatori R, Li Y, et al. Long-acting pasireotide improves clinical signs and quality of life in Cushing’s disease: results from a phase III study. J Endocrinol Invest. (2020) 43(11):1613–22. doi: 10.1007/s40618-020-01246-0

PubMed Abstract | CrossRef Full Text | Google Scholar

37. Hinojosa-Amaya JM, Johnson N, González-Torres C, Varlamov EV, Yedinak CG, McCartney S, et al. Depression and impulsivity self-assessment tools to identify dopamine agonist side effects in patients with pituitary adenomas. Front Endocrinol (Lausanne) (2020) 11:579606. doi: 10.3389/fendo.2020.579606

PubMed Abstract | CrossRef Full Text | Google Scholar

38. Grall-Bronnec M, Victorri-Vigneau C, Donnio Y, Leboucher J, Rousselet M, Thiabaud E, et al. Dopamine agonists and impulse control disorders: a complex association. Drug Saf. (2018) 41(1):19–75. doi: 10.1007/s40264-017-0590-6

PubMed Abstract | CrossRef Full Text | Google Scholar

Keywords: somatostatin, pasireotide, cabergoline, Cushing’s disease, hypercortisolism

Citation: Feelders RA, Fleseriu M, Kadioglu P, Bex M, González-Devia D, Boguszewski CL, Yavuz DG, Patino H, Pedroncelli AM, Maamari R, Chattopadhyay A, Biller BMK and Pivonello R (2023) Long-term efficacy and safety of subcutaneous pasireotide alone or in combination with cabergoline in Cushing’s disease. Front. Endocrinol. 14:1165681. doi: 10.3389/fendo.2023.1165681

Received: 14 February 2023; Accepted: 11 August 2023;
Published: 09 October 2023.

Edited by:

Renato Cozzi, Endocrinology Unit Ospedale Niguarda, Italy

Reviewed by:

Przemyslaw Witek, Warsaw Medical University, Poland
Athanasios Fountas, General Hospital of Athens G. Genimatas, Greece

Copyright © 2023 Feelders, Fleseriu, Kadioglu, Bex, González-Devia, Boguszewski, Yavuz, Patino, Pedroncelli, Maamari, Chattopadhyay, Biller and Pivonello. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Richard A. Feelders, r.feelders@erasmusmc.nl

†Present addresses: Alberto M. Pedroncelli, Chief Medical Office, Camurus AB, Lund, SwedenRicardo Maamari, Global Medical Affairs, Mayne Pharma, Raleigh, NC, United States

‡These authors have contributed equally to this work

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

From https://www.frontiersin.org/articles/10.3389/fendo.2023.1165681/full

Filed under: Cushing's, pituitary, Treatments | Tagged: , , , , | Leave a comment »

« Previous Page — Next Page »