Thin Skin in Cushing’s Syndrome

Abstract

A 53-year-old woman with a history of metastatic small-cell lung cancer was evaluated during an inpatient admission for Cushing’s syndrome on the basis of new findings of hypertension, hypokalemia, hyperglycemia, and metabolic alkalosis.
A focused physical examination was performed to assess for the antianabolic effects of excess cortisol. The thickness of the skin on the back of her third finger was 1.2 mm (reference value, >1.8) when measured with skin calipers (Panels A and B). Thin skin — a clinical sign strongly suggestive of hypercortisolism — results from inhibition of collagen synthesis by glucocorticoids.
To avoid interference from subcutaneous fat, skin thickness should be measured on the backs of the fingers. The measurement can be done with skin calipers (see Video 1) or electrocardiogram calipers (see Video 2). Levels of random plasma cortisol, midnight plasma cortisol, 24-hour urine cortisol, and corticotropin were elevated.
Magnetic resonance imaging of the brain showed no pituitary abnormalities. Whole-body restaging imaging showed new metastatic lesions in the lungs, bones, liver, and meninges. A diagnosis of Cushing’s syndrome — presumed to be paraneoplastic — was made.
After discussing her prognosis with her physicians, the patient opted for palliative care and died 1 week later.

Bone Material Strength index is low in Patients with Cushing’s Syndrome even after long-term remission

Abstract

Objective: Hypercortisolism in endogenous Cushing’s syndrome (CS) results in decreased bone mineral density (BMD) and increased fracture risk. Although after remission BMD improves, fracture rate remains elevated, suggesting that BMD may not adequately reflect fracture risk in this group. The aim was to evaluate bone material properties, another component of bone quality, using Impact Microindentation (IMI) in patients with CS in remission.

Methods: Cross-sectional study in 60 patients and 60 age-, sex-, and BMD-matched controls at a tertiary referral center between 2019 and 2021. Bone material strength index (BMSi) was measured by IMI using the OsteoProbe® device at the tibia. In addition, laboratory investigation, BMD, and vertebral fracture assessment were performed.

Results: By design, patients and controls were comparable for age (median age 56.5 years), sex (48 women), BMD at the lumbar spine and femoral neck. They were also comparable regarding the number of fragility fractures (21 vs. 27, p=0.22). Median time of remission in patients was 6 years (range 1 to 41). Despite comparable BMD, BMSi was significantly lower in patients compared to controls (76.2±6.7 vs 80.5±4.9, p<0.001). In patients, BMSi was negatively correlated with BMI (r= -0.354, p=0.01), but not related to the presence of fracture, physiological hydrocortisone replacement use, other pituitary insufficiencies, or time since remission.

Conclusion: Bone material properties remain altered in patients with endogenous CS, even after long-term remission. These abnormalities, known to be associated with fractures in other populations, may play a role in the persistent bone fragility of steroid excess.

Keywords: Bone Material properties; Bone fragility; Bone quality; Fractures; Impact Microindentation (IMI); Secondary osteoporosis.

PubMed Disclaimer

From https://pubmed.ncbi.nlm.nih.gov/39562003/

Insights on Diagnosing and Managing Cushing’s Syndrome

Cushing’s syndrome, or endogenous hypercortisolemia, is a rare condition that both general practice clinicians and endocrinologists should be prepared to diagnose and treat. Including both the pituitary and adrenal forms of the disease, the Endocrine Society estimates that the disorder affects 10 to 15 people per million every year in the United States. It is more common in women and occurs most often in people between the ages of 20 and 50.

Even though Cushing’s remains a rare disease, cortisol recently made waves at the American Diabetes Association 84th Scientific Session. A highlight of the meeting was the initial presentation of data from the CATALYST trial, which assessed the prevalence of hypercortisolism in patients with difficult-to-control type 2 diabetes (A1c 7.5+).

CATALYST is a prospective, Phase 4 study with two parts. In the prevalence phase, 24% of 1,055 enrolled patients had hypercortisolism, defined as an overnight dexamethasone suppression test (ODST) value greater than 1.8 µg/dL and dexamethasone levels greater than 140 µg/dL. Results of CATALYST’s randomized treatment phase are expected in late 2024.

Elena Christofides, MD, FACE, founder of Endocrinology Associates, Inc., in Columbus, OH, believes the CATALYST results will be a wake-up call for both physicians and patients seeking to advocate for their own health. “This means that nearly 1 in 4 patients with type 2 diabetes have some other underlying hormonal/endocrine dysfunction as the reason for their diabetes, or significant contribution to their diabetes, and they should all be screened,” she said. “All providers need to get comfortable with diagnosing and treating hypercortisolemia, and you need to do it quickly because patients are going to pay attention as well.”

In Dr. Christofides’ experience, patients who suspect they have a hormonal issue may start with their primary care provider or they may self-refer to an endocrinologist. “A lot of Cushing’s patients are getting diagnosed and treated in primary care, which is completely appropriate. But I’ve also met endocrinologists who are uncomfortable diagnosing and managing Cushing’s because it is so rare,” she said. “The important thing is that the physician is comfortable with Cushing’s or is willing to put in the work get comfortable with it.”

According to Dr. Christofides, the widespread popular belief that “adrenal fatigue” is causing millions of Americans to feel sick, tired, and debilitated may be creating barriers to care for people who may actually have Cushing’s. “As physicians, we know that adrenal fatigue doesn’t exist, but we should still be receptive to seeing patients who raise that as a concern,” said Dr. Christofides. “We need to acknowledsalige their lived experience as being very real and it can be any number of diseases causing very real symptoms. If we don’t see these patients, real cases of hypercortisolemia could be left undiagnosed and untreated.”

Dr. Christofides, who also serves as a MedCentral Editor-at-Large, said she reminds colleagues that overnight dexamethasone suppression test (ODST) should always be the first test when you suspect Cushing’s. “While technically a screening test, the ODST can almost be considered diagnostic, depending on how abnormal the result is,” she noted. “But I always recommend that you do the ODST, the ACTH, a.m. cortisol, and the DHEAS levels at the same time because it allows you to differentiate more quickly between pituitary and adrenal problems.”

Dr. Christofides does see a place for 24-hour urine collection and salivary cortisol testing at times when diagnosing and monitoring patients with Cushing’s. “The 24-hour urine is only positive in ACTH-driven Cushing’s, so an abnormal result can help you identify the source, but too many physicians erroneously believe you can’t have Cushing’s if the 24-hour urine is normal,” she explained. “Surgeons tend to want this test before they operate and it’s a good benchmark for resolution of pituitary disease.” She reserves salivary cortisol testing for cases when the patient’s ODST is negative, but she suspects Cushing’s may be either nascent or cyclical.

Surgical resection has long been considered first-line treatment in both the pituitary and adrenal forms of Cushing’s. For example, data shared from Massachusetts General Hospital showed that nearly 90% of patients with microadenomas did not relapse within a 30-year period. A recent study found an overall recurrence rate of about 25% within a 10-year period. When reoperation is necessary, remission is achieved in up to 80% of patients.

As new medications for Cushing’s syndrome have become available, Dr. Christofides said she favors medical intervention prior to surgery. “The best part about medical therapy is you can easily stop it if you’re wrong,” she noted. “I would argue that every patient with confirmed Cushing’s deserves nonsurgical medical management prior to a consideration of surgery to improve their comorbidities and surgical risk management, and give time to have a proper informed consent discussion.”

In general, medications to treat Cushing’s disease rely on either cortisol production blockade or receptor blockade, said Dr. Christofides. Medications that directly limit cortisol production include ketoconazoleosilodrostat (Isturisa), mitotane (Lysodren), levoketoconazole (Recorlev), and metyrapone (Metopirone). Mifepristone (Korlym, Mifeprex) is approved for people with Cushing’s who also have type 2 diabetes to block the effects of cortisol. Mifepristone does not lower the amount of cortisol the body makes but limits its effects. Pasireotide (Signifor) lowers the amount of ACTH from the tumor. Cabergoline is sometimes used off-label in the US for the same purpose.

Following surgery, people with Cushing’s need replacement steroids until their adrenal function resumes, when replacement steroids must be tapered. But Dr. Christofides said she believes that all physicians who prescribe steroids should have a clear understanding of when and how to taper patients off steroids.

“Steroid dosing for therapeutic purposes is cumulative in terms of body exposure and the risk of needing to taper. A single 2-week dose of steroids in a year does not require a taper,” she said. “It’s patients who are getting repeated doses of more than 10 mg of prednisone equivalent per day for 2 or more weeks multiple times per year who are at risk of adrenal failure without tapering.”

Physicians often underestimate how long a safe, comfortable taper can take, per Dr. Christofides. “It takes 6 to 9 months for the adrenals to wake up so if you’re using high-dose steroids more frequently, that will cause the patient to need more steroids more frequently,” she explained. “If you’re treating an illness that responds to steroids and you stop them without tapering, the patient’s disease will flare, and then a month from then to 6 weeks from then you’ll be giving them steroids again, engendering a dependence on steroids by doing so.”

When developing a steroid taper plan for postoperative individuals with Cushing’s (and others), Dr. Christofides suggests basing it on the fact that 5 mg of prednisone or its equivalent is the physiologic dose. “Reduce the dose by 5 mg per month until you get to the last 5 mg, and then you’re going to reduce it by 1 mg monthly until done,” she said. “If a patient has difficulty during that last phase, consider a switch to hydrocortisone because a 1 mg reduction of hydrocortisone at a time may be easier to tolerate.”

Prednisone, hydrocortisone, and the other steroids have different half-lives, so you’ll need to plan accordingly, adds Dr. Christofides. “If you do a slower taper using hydrocortisone, the patient might feel worse than with prednisone unless you prescribe it BID.” She suggests thinking of the daily prednisone equivalent of hydrocortisone as 30 mg to allow for divided dosing, rather than the straight 20 mg/day conversion often used.

What happens after a patient’s Cushing’s has been successfully treated? Cushing’s is a chronic disease, even in remission, Dr. Christofides emphasized. “Once you have achieved remission, my general follow-up is to schedule visits every 6 months to a year with scans and labs, always with the instruction if the patient feels symptomatic, they should come in sooner,” she said.

More on Cushing’s diagnosis and therapies.

https://www.medcentral.com/endocrinology/cushings-syndrome-a-clinical-update

Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Abstract

Objective

Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.

Methods

Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.

Results

In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.

Conclusion

Although the USP8EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Peer Review reports

Introduction

Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [34].

The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.

Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.

Methods

Case series

Study population

Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.

DNA extraction and Sanger sequencing

A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.

Systematic review

Overview of the systematic literature review

We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.

Search strategy

We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.

Inclusion and exclusion criteria

All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.

Results

Case series

Baseline characteristics of the participants

This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).

Frequency of USP8 gene variants

Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).

Fig. 1

figure 1

Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II

Clinical outcomes after surgery

All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).

Systematic review

The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.

Fig. 2
figure 2

Flow diagram of literature search and study selection

In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).

Table 1 Results of systematic literature review
Fig. 3

figure 3

Summary of USP8 mutations in patients with CD in selected studies

USP8 variants and the related pathways in corticotroph adenomas

In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].

Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].

Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].

A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].

DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].

Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma

Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].

In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].

A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].

USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma

Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].

In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].

A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].

Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].

Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].

The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].

Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].

Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].

Analytical conclusion

In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.

We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.

Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [615]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.

Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.

Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [724]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].

There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.

Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22252830]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [242742]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.

There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [3031]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [3738].

In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.

Data availability

The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.

Abbreviations

ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48

References

  1. Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.

  2. Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.

    Article CAS PubMed PubMed Central Google Scholar

  3. Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.

    Article CAS PubMed Google Scholar

  4. Mallari RJ, Thakur JD, Barkhoudarian G, Eisenberg A, Rodriguez A, Rettinger S, Cohan P, Nieman L, Kelly DF. Diagnostic pitfalls in Cushing Disease: Surgical Remission Rates, Test Thresholds, and lessons learned in 105 patients. J Clin Endocrinol Metab. 2022;107(1):205–18.

    Article PubMed Google Scholar

  5. Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.

    Article PubMed Google Scholar

  6. Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.

    Article CAS PubMed Google Scholar

  7. Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.

    Article CAS PubMed PubMed Central Google Scholar

  8. Rebollar-Vega RG, Zuarth-Vázquez JM, Hernández-Ramírez LC. Clinical spectrum of USP8 pathogenic variants in Cushing’s Disease. Arch Med Res. 2023;54(8):102899.

    Article CAS PubMed Google Scholar

  9. Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.

    Article CAS PubMed PubMed Central Google Scholar

  10. Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.

    Article PubMed Google Scholar

  11. Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.

    Article CAS PubMed PubMed Central Google Scholar

  12. Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.

  13. Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.

    Article CAS PubMed Google Scholar

  14. Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.

    Article CAS PubMed Google Scholar

  15. Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.

    Article CAS PubMed PubMed Central Google Scholar

  16. Martins CS, Camargo RC, Coeli-Lacchini FB, Saggioro FP, Moreira AC, de Castro M. USP8 mutations and cell cycle regulation in Corticotroph Adenomas. Horm Metab Res. 2020;52(2):117–23.

    Article CAS PubMed Google Scholar

  17. Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.

    Article CAS PubMed Google Scholar

  18. Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.

    Article CAS PubMed Google Scholar

  19. Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.

    Article PubMed PubMed Central Google Scholar

  20. Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.

    Article PubMed Google Scholar

  21. Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.

    Article PubMed Google Scholar

  22. Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.

    Article CAS PubMed PubMed Central Google Scholar

  23. Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.

    Article PubMed PubMed Central Google Scholar

  24. Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.

  25. Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.

    Article CAS PubMed Google Scholar

  26. Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.

    Article CAS PubMed PubMed Central Google Scholar

  27. Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.

    Article CAS PubMed Google Scholar

  28. Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.

    Article CAS PubMed PubMed Central Google Scholar

  29. Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.

    Article CAS PubMed Google Scholar

  30. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.

    Article CAS PubMed Google Scholar

  31. Albani A, Perez-Rivas LG, Tang S, Simon J, Lucia KE, Colón-Bolea P, Schopohl J, Roeber S, Buchfelder M, Rotermund R, et al. Improved pasireotide response in USP8 mutant corticotroph tumours in vitro. Endocr Relat Cancer. 2022;29(8):503–11.

    Article CAS PubMed Google Scholar

  32. Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.

    Article CAS PubMed PubMed Central Google Scholar

  33. Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.

    Article CAS PubMed PubMed Central Google Scholar

  34. Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.

  35. Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.

    Article CAS PubMed Google Scholar

  36. Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.

    Article PubMed PubMed Central Google Scholar

  37. Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.

    Article CAS PubMed PubMed Central Google Scholar

  38. Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.

    Article CAS PubMed Google Scholar

  39. Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, Serban A, Ferrante E, Locatelli M, Lania AG, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. 2021;28(8):573–82.

    Article CAS PubMed Google Scholar

  40. Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.

    Article PubMed Google Scholar

  41. Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.

    CAS PubMed Google Scholar

  42. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S. Transforming growth factor-alpha stimulates proliferation of mammotrophs and corticotrophs in the mouse pituitary. J Endocrinol. 2000;165(2):493–501.

    Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank all the participants enrolled in this study.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.

Author information

Author notes

  1. Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.

Authors and Affiliations

  1. Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran

    Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh

  2. Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran

    Ali Zare Mehrjardi

  3. Department of Endocrinology, Arad Hospital, Tehran, Iran

    Mahmoud Reza Kaynama

Contributions

Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad E. Khamseh.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature

Skip to figshare navigation

Below is the link to the electronic supplementary material.

Cite this article

Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord 24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z

Download citation

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable linkProvided by the Springer Nature SharedIt content-sharing initiative

Keywords

From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-024-01619-z

Epigenetic Mechanisms Modulated by Glucocorticoids With a Focus on Cushing Syndrome

Abstract

In Cushing syndrome (CS), prolonged exposure to high cortisol levels results in a wide range of devastating effects causing multisystem morbidity. Despite the efficacy of treatment leading to disease remission and clinical improvement, hypercortisolism-induced complications may persist. Since glucocorticoids use the epigenetic machinery as a mechanism of action to modulate gene expression, the persistence of some comorbidities may be mediated by hypercortisolism-induced long-lasting epigenetic changes. Additionally, glucocorticoids influence microRNA expression, which is an important epigenetic regulator as it modulates gene expression without changing the DNA sequence. Evidence suggests that chronically elevated glucocorticoid levels may induce aberrant microRNA expression which may impact several cellular processes resulting in cardiometabolic disorders.

The present article reviews the evidence on epigenetic changes induced by (long-term) glucocorticoid exposure. Key aspects of some glucocorticoid-target genes and their implications in the context of CS are described. Lastly, the effects of epigenetic drugs influencing glucocorticoid effects are discussed for their ability to be potentially used as adjunctive therapy in CS.

In Cushing syndrome (CS), adrenocorticotropic hormone (ACTH) hypersecretion by a pituitary adenoma or an ectopic source, or autonomous cortisol hypersecretion by an adrenal tumor, induces chronic endogenous hypercortisolism with loss of the cortisol circadian rhythm (1). CS is more prevalent in women than men and frequently occurs in the fourth to sixth decades of life (2).

Glucocorticoids (GC) have extensive physiological actions and regulate up to 20% of the expressed genome, mainly related to the immune system, metabolic homeostasis, and cognition. Therefore, the prolonged exposure to high cortisol levels results in a wide range of devastating effects, including major changes in body composition (obesity, muscle atrophy, osteoporosis), neuropsychiatric disturbances (impaired cognition, depression, sleep disturbances), the metabolic syndrome (obesity, hypertension, insulin resistance, and dyslipidemia), hypercoagulability, and immune suppression (34). The consequences of hypercortisolism lead to compromised quality of life and increased mortality rate (5). The mortality rate in patients with CS is 4 times higher than the healthy control population (6). Risk factors such as obesity, diabetes, and hypertension contribute to the increased risk of myocardial infarction, stroke, and cardiac insufficiency. As a result, cardiovascular disease is the leading cause of the premature death in CS (5). Infectious disease is also an important cause of death in CS (5). Therefore, prompt treatment to control hypercortisolism is imperative to prevent complications and an increased mortality rate.

Despite the efficacy of treatment leading to disease remission, the clinical burden of CS improves, but does not completely revert, in every patient (7). Indeed, obesity, neuropsychiatric disturbances, hypertension, diabetes, and osteoporosis persist in a substantial number of biochemically cured patients. For instance, in a study involving 118 CS patients in remission for about 7.8 years (median), resolution of comorbidities such as diabetes occurred in only 36% of cases, hypertension in 23% of cases, and depression in 52% of the cases (8). It has been proposed that epigenetic changes as a consequence of hypercortisolism is a mechanism of the persistence of some comorbidities (9-12).

Epigenetics is a reversible process that modifies gene expression without any alterations in DNA sequence; frequently it is mediated by histone modification and DNA methylation together with microRNAs (13-15). GCs use the epigenetic machinery as a mechanism of action to regulate gene expression in physiological circumstances, such as metabolic actions and stress response. Its networks involve DNA and histone modifying enzymes, such as DNA methyltransferases (DNMTs), histone acetyltransferases (HATs), and histone deacetylases (HDACs) (16). (Fig. 1) The DNA methylation process catalyzed by DNMTs is usually associated with downregulation of gene expression (17). Histone modifications catalyzed by HAT enzymes induce gene transcription, while those by HDAC enzymes induce transcriptional repression (17). Drugs interfering with these enzymes (so-called epigenetic drugs) may affect the GC genomic actions confirming the interaction between GC and the epigenetic system (1819). Furthermore, GC can modulate HDAC and DNMT expression and activity (161920). Based on these data it might be speculated that in CS, epigenetic modifications induced by long-term GC exposure plays a role in the development of the disease-specific morbidity (910).

Figure 1.

Glucocorticoid (GC) and its epigenetic machinery. GC through its receptor interacts with DNA and histone modifying enzymes, such as DNA methyltransferases (DNMTs), histone acetyl transferases (HATs), and histone deacetylases (HDAC) to modulate gene expression.

In this review we provide an overview of epigenetic aspects of GC action in physiological conditions and in the context of CS. We start with a detailed characterization of how GC, using the epigenetic system, can change chromatin structure in order to activate or silence gene expression. (Fig. 2) Subsequently, we describe the role of epigenetic mechanisms in the regulation of expression of several GC-target genes related to CS. Finally, we present the current evidence of epigenetic changes caused by the long-term of GC exposure and the potential use of epidrugs influencing GC actions.

Figure 2.

Epigenetic mechanisms of the glucocorticoid action to regulate gene expression. The GR is located in cytoplasm in a multi-protein complex; after GC binding, GR dissociates from the multi-protein complex, crosses the nuclear membrane, dimerizes, and binds to the GRE of the target gene. One of the mechanisms of action of GC is through the recruitment of co-regulators together with epigenetic enzymes, such as HAT, to change the chromatin structure, resulting in activation of gene transcription. Also, GR decreases gene expression by tethering other transcriptional factors and recruiting HDAC2, causing histone deacetylation, which leads to a repressed chromatin. GC can cause hypomethylation through downregulation in the expression of DNMT1. Abbreviations: Ac, acetylation; DNMT1, DNA methyltransferase 1; GC, glucocorticoid; GR, glucocorticoid receptor; GRE, glucocorticoid responsive elements; HAT, histone acetyltransferase; HDAC, histone deacetylases; Me: methylation.

Search Strategy

A search of the PubMed database was conducted using the advanced search builder tool for articles in the English language on the following terms “glucocorticoids,” “glucocorticoid receptor,” “Cushing,” “hypercortisolism,” “epigenetic,” “DNA methylation,” “histone deacetylase,” “histone acetyltransferase,” “microRNA” “fkbp5,” “clock genes,” and “POMC.” Moreover, references were identified directly from the articles included in this manuscript. The articles were selected by the authors after being carefully analyzed regarding their importance and impact.

Epigenetic Aspects of Genomic Action of Glucocorticoids

GCs regulate gene expression positively or negatively. GC-responsive genes include genes encoding for proteins associated with inflammation, metabolic processes, blood pressure and fluid homeostasis, apoptosis, cell cycle progression, circadian rhythm, and intracellular signaling (21).

The GC actions are cell type–specific (22). For instance, in an in vitro study, the comparison of GC-expressed genes between 2 cell lines, corticotroph (AtT20) and mammary (3134) cell lines, showed a different set of GC-regulated genes, revealing the cell type–specific nature of GC effects (23). GC function depends on the accessibility of glucocorticoid receptor (GR)-binding sites in the DNA of the target tissue, which in turn is mostly established during cell differentiation. Therefore, different chromatin organization explains the distinct GR-binding sites among different tissues (222425). The chromatin accessibility is determined by histone modifications such as acetylation, methylation, phosphorylation, and/or DNA methylation, processes that are both dynamic and reversible (26).

Furthermore, gene expression is regulated in a GC-concentration-dependent manner which is tissue-specific. Only a few genes can be upregulated or downregulated at low concentrations of GC. For example, a dose of dexamethasone (Dex) as low as 0.5 nM selectively activated PER1 (period 1, transcription factor related to circadian rhythm) expression in lung cancer (A549) cells (2127). Additionally, continuous GC exposure or pulsed GC (cortisol fluctuation during circadian rhythm) may cause different responses with respect to gene expression (2628). For example, constant treatment with corticosterone induced higher levels of PER1 clock gene mRNA expression compared with pulsatile treatment, as demonstrated in an in vitro study using 3134 cell line (28).

The time course for gene expression in response to Dex is fast, with repression occurring slightly slower compared to activation. Half of activated and repressed genes are detected within, respectively, about 40 minutes and 53 minutes following Dex exposure (21).

In short, the transcriptional output in response to GC depends on cell type, as well as on the duration and intensity of GC exposure (21242627). GCs act as a transcriptional regulatory factor resulting in activating or repressing the expression of genes. The GC exerts its function through binding to corticosteroid receptors, specifically, the mineralocorticoid receptor and the GR, members of the nuclear receptor superfamily (2930).

Glucocorticoid Receptor

The GR is located in the cytoplasm in a chaperone complex which includes heat-shock proteins (70 and 90) and immunophilins (such as FK506 binding protein [FKBP5]). Cortisol diffuses across the cell membrane and binds with high affinity to the GR. The activated GR bound to GC dissociates of the multi-protein complex and is transferred to the nucleus, where it ultimately regulates gene expression (2631).

GR is a transcription factor encoded by nuclear receptor subfamily 3, group C member 1 (NR3C1) gene, located in chromosome 5, and consisting of 9 exons. It is composed of 3 major functional domains, namely a DNA binding domain (DBD), the C-terminal ligand-binding domain (LBD) and the N-terminal domain (NTB). The LBD recognizes and joins the GC. NTB contains an activation function-1 (AF1) which connects with co-regulators and the members of the general transcription machinery to activate target genes. The DBD comprises 2 zinc fingers motifs that are able to identify and bind to glucocorticoid responsive elements (GREs) (3233).

GRα is the most expressed and functionally active GR. GRβ is another isoform which is the result of an alternative splicing in exon 9 of the GR transcript. The difference between the 2 isoforms is the distinct ligand-binding domain in GRβ. This variance prevents the GRβ from binding to GC. In fact, the GRβ counteracts GRα function by interfering with its binding to a GRE in the target gene, and GRβ expression is associated with GC resistance (32). In addition, GRβ has its own transcriptional activity which is independent and distinct from GRα (34).

Another splice variant of human GR, GRγ, is associated with GC resistance in lung cell carcinoma and childhood acute lymphoblastic leukemia (3335). There is an additional amino acid (arginine) in the DBD of the GRγ that reduces, by about half, the capacity to activate or suppress the transcription of the target gene, as compared with GRα (32). One study identified GRγ in a small series of corticotroph adenomas (36).

Glucocorticoid Mechanism of Action

The GR-GC complex induces or represses gene expression directly by binding to DNA, indirectly by tethering other transcription factors or yet in a composite manner that consists in binding DNA in association with binding to other co-regulators (3537).

The GR has the ability to reorganize the chromatin structure to become more or less accessible to the transcriptional machinery. In the classical mechanism of direct induction of gene expression, the GR dimerizes and binds to a GRE in DNA. The receptor recruits co-regulators, such as CREB binding protein, which has intrinsic histone acetyltransferase (HAT) activity that modifies the chromatin structure from an inactive to an active state. This model, called transactivation, upregulates the expression of some genes related to glucose, protein, and fat metabolism. Gene repression, on the other hand, is accomplished by GR binding to a negative GRE (nGRE) leading to the formation of a chromatin remodeling complex composed by co-repressor factors, such as NCOR1 and SMRT, and histone deacetylases (HDACs), that ultimately turn chromatin less accessible and suppress gene transcription. The gene repression through direct binding events occurs less frequently when compared to gene induction (253538).

Another mechanism of GC action is through binding to other transcription factors (tethering). In case of switching off inflammatory genes, GR binds to transcriptional co-activator molecules, such as CREB binding protein with intrinsic HAT activity, and subsequently recruits HDAC2 to reverse histone acetylation, thus resulting in a suppression of the activated inflammatory gene (39). In the same model, GC interacts with other cofactors, such as the STAT family, to induce chromatin modifications resulting in increased gene expression (26).

Furthermore, the transcriptional dynamics of some genes follow a composite manner. In this model, GR, in conjunction with binding to GRE, also interacts with cofactors in order to enhance or reduce gene expression (35).

GCs can also modulate gene expression by influencing the transcription of epigenetic modifiers. An experimental study demonstrated that GC mediated the upregulation of HDAC2 in rats exposed to chronic stress, which in turn decreased the transcription of histone methyltransferase (Ehmt2) that ultimately upregulated the expression of Nedd4. Nedd4 is a ubiquitin ligase, expression of which has been related to cognitive impairment (40). Additionally, GC was found to interact with another epigenetic eraser, namely JMJD3, a histone demethylase, suppressing its transcription in endothelial cells treated with TNFα that led to decreased expression of other genes related to the blood-brain barrier (41).

GCs have the ability to induce (de)methylation changes in DNA, ultimately affecting gene expression. The DNA methylation process triggered by GC involves the family of DNA methyltransferases (DNMT) and ten-eleven translocation (TET) protein (2042-44). The DNMT, DNMT1, DNMT3A, and DNMT3B are able to transfer a methyl group to a cytosine residue in DNA, forming 5-methylcytosine (5mC), which negatively impacts gene expression. In contrast, TET protein chemically modifies the 5mC to form 5-hydroxymethylcytosine (5hmC), which ultimately leads to unmethylated cytosine, positively influencing gene expression (45).

Glucocorticoids mainly induce loss of methylation events rather than gain of methylation across the genome (1146). The DNA demethylation process can be either active or passive. The active mechanism is linked to the upregulation of TET enzyme expression that follows GC treatment, which was described in retinal and osteocyte cell line model studies (4243). The passive demethylation event involves the downregulation (Fig. 2) or dysfunction of DNMT1. DNMT1 is responsible for maintaining the methylation process in dividing cells (45). In case of GC exposure, GC can cause hypomethylation through downregulation in the expression of DNMT1, a process described in the AtT20 corticotroph tumor cell model, or through GC hindering DNMT activity, particularly DNMT1, as demonstrated in the retinal cell (RPE) line (204244).

Glucocorticoid-Induced Epigenetic Changes

There are several molecular mechanisms connecting GR activation and epigenetic modifications ultimately affecting gene expression (Fig. 2). As described above, GC uses epigenetic machinery, such as DNA and histone modifying enzymes, to restructure the chromatin in order to induce or silence gene transcription (1647).

In an in vitro study using murine AtT20 corticotroph tumor and neuronal cell lines, after chronic GC exposure followed by a recovery period in the absence of GC, the cells retained an “epigenetic memory” with persistence of loss of methylation content in FKBP5 gene but with no increased gene expression at baseline. The functionality of this “epigenetic memory” only became evident in a second exposure to GC, when the cells responded sharply with a more robust expression of FKBP5 gene compared to the cells without previous exposure to GC (44). Another in vitro study, using a human fetal hippocampal cell line, confirmed long-lasting DNA methylation changes induced by GC. The cells were treated for 10 days with dexamethasone, during the proliferative and cell differentiation phases of the cell line, followed by 20 days without any treatment. The second exposure to GC resulted in an enhanced gene expression of a subset of GC-target genes (48). Additionally, using an animal model subjected to chronic stress, a distinct gene expression profile was demonstrated in response to acute GC challenge compared to those without chronic stress history. The proposed mechanism was that chronic stress resulted in GC-induced enduring epigenetic changes in target genes, altering the responsiveness to a subsequent GC exposure (49).

In general, it seems that the majority of differential methylation regions (DMRs) induced by GC are loss of methylation rather than gain of methylation. In an experimental study, an association between hypomethylation and GC exposure was demonstrated in mice previously exposed to high levels of GC. Further analysis demonstrated that the genes linked with DMR were mostly related to metabolism, the immune system, and neurodevelopment (11).

Human studies have also shown that excess of cortisol can induce modifications in DNA methylation. DNA methylation data obtained from whole blood samples from patients with chronic obstructive pulmonary disease (COPD) treated with GC revealed DMR at specific CpG dinucleotides across the genome. These DMR were confirmed by pyrosequencing and annotated to genes, such as SCNN1A, encoding the α subunit of the epithelial sodium channel, GPR97, encoding G protein coupled receptor 97, and LRP3, encoding low-density lipoprotein receptor-related protein 3 (50). Furthermore, it has been proposed that the negative impact of chronic GC exposure on the immune system, which increases the risk of opportunistically infections, may be epigenetically mediated (51). In a clinical study, using whole blood samples, an analysis of genome-wide DNA methylation was performed on patients before and after exposure to GC (51). Long-term GC exposure disrupts, through a persistent modification of the cytosine methylation pattern, the mTORC1 pathway which affects CD4+ T cell biology (51).

Taken together, these data clearly show the interplay between GC signaling and methylation and histone modifications processes suggesting that GC interferes in the epigenetic landscape modulating gene expression. It is possible that most of these GC-induced epigenetic events are dynamic and temporary, while others may persist leading to long-lasting disorders. Further research to provide insight into what makes some events reversible is warranted.

Epigenetic Changes as a Consequence of Long-Term Glucocorticoid Exposure in Cushing Syndrome

The comorbidities associated with CS are associated with increased mortality mainly due to cardiovascular events (52). GC-induced comorbidities in CS may be at least in part epigenetically mediated. Previous study using whole blood methylation profile demonstrated that specific hypomethylated CpG sites induced by GC were associated with Cushing comorbidities, such as hypertension and osteoporosis (46). The study identified a methylator predictor of GC excess which could be used as a biomarker to monitor GC status (46).

The long-term exposure to high cortisol levels may be crucial for the persistence of some morbidities in CS through epigenetic changes. Hypercortisolism-induced persistent changes in visceral adipose tissue gene expression through epigenetic modifications was investigated in a translational study (12). This study combined data from patients with active CS and data from an animal model of CS in active and remitted phase. Interestingly, the study demonstrated long-lasting changes in the transcriptome of adipose tissue that were associated with histone modifications induced by GC. Therefore, these epigenetic fingerprints observed even after the resolution of hypercortisolism may elucidate the mechanism of persistent modifications in gene expression in the visceral adipose tissue (12).

With regard to the persistence of GC-induced DMR, a genome-wide DNA methylation analysis showed a lower average of DNA methylation in patients in remission of CS compared to controls. Interestingly, the most common biologically relevant affected genes were retinoic acid receptors, thyroid hormone receptors, or hormone/nuclear receptors, important genes related to intracellular pathways and regulators of gene expression (9).

In summary, this large body of evidence supports the concept that prolonged GC exposure modulates the epigenetic landscape across the genome by inducing DMR and histone modifications. Some epigenetic modifications are persistent, and this may partially explain the incomplete reversibility of some of CS features following clinical remission.

Glucocorticoid-Target Genes in Cushing Syndrome

A detailed identification and characterization of GC-target genes may shed light in the understanding of the pathophysiology and treatment response in patients with CS. For instance, the GC regulation of pro-opiomelanocortin (POMC) expression as part of the physiologic GC negative feedback may be impaired in Cushing disease (CD), which is an important mechanism for the maintenance of high GC levels (53). Another example is the interaction between GC and clock genes, which may interfere in the loss of the GC circadian rhythm and may contribute to metabolic disorders in CS (54). Furthermore, the suppressive action of GC on drug targets, such as the somatostatin receptor (subtype 2), may influence the efficacy of first-generation somatostatin receptor ligands in normalizing cortisol levels in CD (55). Here we describe how GCs using epigenetic machinery influence the expression of important target genes and their implications in CS.

FKBP5

FK506 binding protein (FKBP5) plays an important role in the regulation of hypothalamic-pituitary-adrenal (HPA) system (56). As part of the GC negative feedback loop, GC binds to hypothalamic and pituitary GR. In the cytoplasm, GR is bound to a multi-protein complex including FKBP5. FKBP5 modulates GR action by decreasing GR binding affinity to GC and by preventing GR translocation from cytoplasm to nucleus (5758). In other words, an increase of FKBP5 expression is inversely correlated with GR activity and results in GC resistance leading to an impaired negative feedback regulation in the HPA axis (59).

FKBP5 is a GC-responsive gene; its upregulation by GC is part of an intracellular negative short-feedback loop (60). The mechanism by which GC regulates FKBP5 expression was shown to include inhibition of DNA methylation (44). In a model for CS, mice treated with corticosterone for 4 weeks had a reduced level of DNA methylation of FKBP5 in DNA extracted from whole blood, which was strongly correlated in a negative manner with GC concentration. Interestingly, a negative correlation was also observed between the degree of FKBP5 gene methylation measured at 4 weeks of GC exposure and the percentage of mice visceral fat (61). Accordingly, previous studies have provided compelling evidence of decreased methylation in the FKBP5 gene in patients with active CS compared to healthy control (1046). Even in patients with CS in remission, previous data have suggested a small decrease in FKBP5 methylation levels compared to healthy controls (910). In an in vitro study, it was demonstrated that, by decreasing DNMT1 expression, GC is able to reduce FKBP5 methylation levels and, therefore, increase its expression (44).

Likewise, FKBP5 mRNA is also sensitive to GC exposure. A time-dependent increase in blood FKBP5 mRNA after single-dose prednisone administration has been demonstrated in healthy humans (62). Accordingly, patients with ACTH-dependent CS had higher blood FKBP5 mRNA levels compared with healthy controls, and after a successful surgery, FKBP5 mRNA returned to baseline levels (63). Furthermore, in another study, blood FKBP5 mRNA was inversely correlated with FKBP5 promoter methylation and positively correlated with 24-hour urine free cortisol (UFC) levels in patients with CS (46). Taken together, this fine-tuning of FKBP5 DNA methylation and mRNA according to the level of GC suggests that FKBP5 can be used as a biomarker to infer the magnitude of GC exposure.

POMC and Corticotropin-Releasing Hormone

The partial resistance of the corticotroph adenoma to GC negative feedback is a hallmark of CD. Indeed, the lack of this inhibitory effect constitutes a method to diagnose CD, that is, with the dexamethasone suppression test. One of the mechanisms related to the insensitivity to GC can be attributed to GR mutations which are, however, rarely found in corticotrophinomas (64). Another mechanism that was uncovered in corticotroph adenomas is an overexpression of the HSP90 chaperone resulting in reduced affinity of GR to its ligand and consequently GR resistance (5365).

In addition, the loss of protein expression of either Brg1, ATPase component of the SWI/SNF chromatin remodeling complex, or HDAC2 has been linked to GC resistance in about 50% of some adenomas (66). The trans-repression process on POMC transcription achieved by GC involves both the histone deacetylation enzyme and Brg1. One mechanism of corticotropin-releasing hormone (CRH)-induced POMC expression is through an orphan nuclear receptor (NR) related to NGFI-B (Nur77). NGFI-B binds to the NurRE sequence in the promoter region of POMC gene and recruits a co-activator to mediate its transcription. In a tethering mechanism, the GR directly interacts with NGFI-B to form a trans-repression complex, which contains the GR itself, Brg1, the nuclear receptor, and HDAC2; the latter being essential to block the gene expression through chromatin remodeling process (5366).

In CD, hypercortisolism exerts a negative feedback at CRH secretion from the hypothalamus (67). The mechanism involved in GR-induced suppression of CRH expression is through direct binding to a nGRE in the promoter region of CRH gene and subsequent recruitment of repressor complexes. In a rat hypothalamic cell line, it was demonstrated that Dex-induced CRH repression occurs through coordinated actions of corepressors involving Methyl-CpG-binding protein 2 (MeCP2), HDAC1, and DNA methyltransferase 3B (DNMT3B). Possibly, GR bound to nGRE recruits DNMT3B to the promoter in order to methylate a specific region, subsequently binding MeCP2 on these methylated sites followed by the recruitment of chromatin modify corepressor HDAC1, ultimately resulting in CRH suppression. Another possibility is that 2 independent complexes, one consisting of GR with DNMT3 for the methylation and the other the MeCP2, bound to methylated region, interact with HDAC1 to induce repression (68).

Clock Genes

The clock system and the HPA axis are interconnected regulatory systems. Cortisol circadian rhythm is modulated by the interaction between a central pacemaker, located in the hypothalamic suprachiasmatic nuclei, and the HPA axis (69). At the molecular level, mediators of the clock system and cortisol also communicate with each other, both acting as transcription factors of many genes to influence cellular functions.

In CS, the impact of chronic GC exposure on clock genes expression was recently evaluated using peripheral blood samples from patients with active disease compared with healthy subjects. The circadian rhythm of peripheral clock gene expression (CLOCK, BMAL, PER1-3, and CRY1) was abolished as a result of hypercortisolism, and that may contribute to metabolic disorders observed in Cushing patients (70). Another study, which investigated persistent changes induced by hypercortisolism in visceral adipose tissue, found that the expression of clock genes, such as PER1, remained altered in association with persistent epigenetic changes in both H3K4me3 and H3K27ac induced by hypercortisolism even after the resolution of hypercortisolism (12). This suggests that chronic exposure to GC may induce sustained epigenetic changes that can influence clock genes expression. Nevertheless, further studies are warranted to better elucidate how long-term exposure to GC impacts clock genes expression using the epigenetic machinery.

Glucocorticoid Effects on MicroRNAs

Along with histone modification and DNA methylation, microRNAs (miRNAs) have emerged as an epigenetic mechanism capable of impacting gene expression without changing DNA sequence (15). Interestingly, miRNA expression itself is also under the influence of epigenetic modifications through promoter methylation like any other protein-encoding genes (71).

MicroRNAs are small (about 20-25 nucleotides in length) non-coding RNAs that are important in transcriptional silencing of messenger RNA (mRNA). By partially pairing with mRNA, miRNAs can either induce mRNA degradation or inhibit mRNA translation to protein. MiRNAs regulate the translation of about 50% of the transcriptome, allowing them to play an important role in a wide range of biological functions, such as cell differentiation, proliferation, metabolism, and apoptosis under normal physiological and pathological situations. Some miRNAs can be classified as oncogenes or tumor suppressing genes, and aberrant expression of miRNAs may be implicated in tumor pathogenesis (71-73).

Insight into the regulation of miRNA expression is, therefore, crucial for a better understanding of tumor development and other human diseases, including cardiac, metabolic, and neurological disorders (7374). There are different regulatory mechanisms involved in miRNA expression, including transcriptional factors such as GR-GC. GC may modulate miRNA expression through direct binding to GRE in the promoter region of the host gene, as observed in hemopoietic tumor cells (75). In addition to transcriptional activation, in vascular smooth muscle cells, Dex treatment induces downregulation of DNMT1 and DNMT3a protein levels and reduces the methylation of miRNA-29c promoter, resulting in an increased expression of miRNA-29c (76). Interestingly, it was demonstrated that the increased expression of miRNA-29 family (miRNA-29a, -29b, and -29c) associates with metabolic dysfunction, such as obesity and insulin resistance, which pertains to CS (7778). With regard to metabolic dysfunction, miRNA-379 expression was shown to be upregulated by GC and its overexpression in the liver resulted in elevated levels of serum triglycerides associated with very low-density lipoprotein (VLDL) fraction in mice (79). In obese patients, the level of hepatic miRNA-379 expression was higher compared to nonobese patients and positively correlated with serum cortisol and triglycerides (79). Hence, GC-responsive miRNA may be, at least in part, a mediator to GC-driven metabolic conditions in CS.

In pathological conditions, such as seen in CS, prolonged exposure to an elevated cortisol level results in a wide range of comorbidities. It can be hypothesized that the chronic and excessive glucocorticoid levels may induce an aberrant miRNA expression that might impact several cellular processes related to bone and cardiometabolic disorders. A recent study addressed the impact of hypercortisolism on bone miRNA of patients with active CD compared to patients with nonfunctional pituitary adenomas. Significant changes in bone miRNA expression levels were observed, suggesting that the disruption of miRNA may be partially responsible for reduced bone formation and osteoblastogenesis (80). Similarly, altered expression levels of selected miRNAs related to endothelial biology in patients with CS may point to a contribution to a high incidence of cardiovascular disorders in Cushing patients (81). Therefore, dysregulated miRNAs as a consequence of high cortisol levels may underpin the development and progression of comorbidities related to CS. To the best of our knowledge, it is currently not clear whether miRNA dysregulation persists after resolution of hypercortisolism, thus contributing to the persistence of some comorbidities. This hypothesis needs to be further investigated.

MicroRNA can also be used as a diagnostic tool in CS. A study was performed to identify circulating miRNA as a biomarker to differentiate patients with CS from patients with suspected CS who had failed diagnostic tests (the control group) (82). It was observed that miRNA182-5p was differentially expressed in the CS cohort compared to the control group; therefore, it may be used as a biomarker (82). However, a large cohort is necessary to validate this finding (82). In corticotroph tumors, downregulation of miRNA 16-1 expression was observed relative to normal pituitary tissue (83). In contrast, the plasma level of miRNA16-5p was found to be significantly higher in CD compared to ectopic Cushing (EAS) and healthy controls (84). This finding suggests that miRNA16-5p may be a biomarker capable to differentiate the 2 forms of ACTH-dependent Cushing (84).

Epidrugs and Glucocorticoid Action in Cushing’s Syndrome

The interest in understanding the epigenetic mechanism of GC action in the context of CS is based on reversibility of epi-marks, such as DNA methylation and histone modifications, using epidrugs (8586). The biological characteristics of epigenetic drugs and their target have been extensively explored. Their effectiveness as antitumor drugs have been tested on corticotroph tumors using in vitro studies (87-89). However, a limited number of studies have explored the role of epidrugs as a therapeutic tool in reversing the genomic action of GC in CS, particularly in comorbidities induced by hypercortisolism (9091).

The use of histone deacetylase inhibitors (HDACi) may reduce the genomic action of GC (90-92). It has been demonstrated that the use of the HDAC inhibitor valproic acid increases the acetylation level of GR, consequently attenuating the genomic action of GC. In an experimental Cushing model in rats, the use of valproic acid decreased expression of genes related to lipogenesis, gluconeogenesis, and ion regulators in the kidney that ultimately reduces hepatic steatosis, hyperglycemia, and hypertension in ACTH-infused rats (9091).

More studies evaluating the effects of epidrugs influencing the GC actions are warranted to further elucidate the underlying mechanisms and to explore potential treatment modalities to reverse long-lasting consequences of chronic corticoid exposure.

Conclusions

In physiologic conditions, GC are secreted in pulses following a circadian rhythm pattern, as opposed to a constant, chronic, and high GC exposure in CS. This pathological pattern may account for numerous devastating effects observed in CS (7). Yet, the expressed genome in response to chronic GC exposure may potentially be abnormal, leading to dysregulation in clock genes, among other effects.

GC levels may return to a normal circadian pattern in response to a successful treatment, but with incomplete reversibility of some CS features, which may in part be explained by epigenetic changes. The epigenetic machinery is used by GC to induce dynamic changes in chromatin to modulate gene expression. (Fig. 2) It seems that most of chromatin modifications are reversible, but some may persist resulting in long-term epigenetic changes. (Table 1)

Table 1.

Evidence of interaction between glucocorticoid and epigenetic machinery

Epigenetic changes/epigenetic enzymes Action
Histone acetylation (HAT)
  • Glucocorticoid receptors (GR) recruit co-regulators, such as CREB binding protein (CBP), which has intrinsic histone acetyltransferase (HAT) activity that modifies the chromatin structure from an inactive to an active state (253335).

Histone deacetylation (HDAC)
  • GR recruit histone deacetylases (HDACs) to turn chromatin less accessible and suppress gene transcription (2535).

  • The trans-repression process on POMC transcription achieved by glucocorticoids (GC) involves the histone deacetylation enzyme (HDAC2).

  • GC mediates the upregulation of HDAC2 in rats exposed to chronic stress (40).

Histone demethylase (JMJD3)
  • GC suppress transcription of JMJD3 in endothelial cells treated with TNFα (41).

Histone modifications
  • Using ChIP-seq, a study in mice treated for 5 weeks with corticosterone showed higher levels of histone modifications (H3K4me3, H3K27ac) compared to control mice. In mice after a 10-week washout period, persistence of this epigenetic fingerprint was observed, which was associated with long-lasting changes in gene expression (12).

DNA methylation (DNMT3B) and histone deacetylation (HDAC1)
  • GC mediates CRH downregulation through DNMT3B to the promoter in order to methylate a specific region and recruitment of chromatin modify corepressor HDAC (68).

DNA hypomethylation
  • GC induces downregulation of DNMT1 in AtT20 (mouse corticotroph adenoma cell line) (20).

  • GC induces upregulation of TET enzyme expression which was described in retinal and osteocyte cell line model (4243).

  • An experimental study in mice previously exposed to high levels of GC showed differentially methylated regions (DMR) induced by GC treatment, of which the majority was loss of the methylation (11).

  • Reduced DNA methylation in FKBP5 gene was found in patients in active disease and also in remission state of Cushing syndrome (CS) as compared to a healthy control group (10).

  • A genome-wide DNA methylation analysis showed a lower average of DNA methylation in patients in remission of CS compared to controls (9).

  • A study using whole blood methylation profile demonstrated an association between cortisol excess and DNA hypomethylation in patients with CS (46).

Further studies are needed to elucidate how chronic exposure to GC leads to incomplete reversibility of CS morbidities via sustained modulation of the epigenetic machinery and possibly other mechanisms. Subsequent identification of therapeutic targets may offer new perspective for treatments, for example, with epidrugs, aiming to reverse hypercortisolism-related comorbidities.

Funding

The authors received no financial support for this manuscript.

Disclosures

T.P., R.A.F., and L.J.H. have nothing to declare.

Data Availability

Data sharing is not applicable to this article, as no datasets were generated or analyzed during the current study.