Early diagnosis and immediate treatment of Cushing’s syndrome (CS) are critical for a better prognosis but remain a challenge. However, few comprehensive reports have focused on this issue or investigated whether patient-reported manifestations are consistent with physician-assessed symptoms of CS. This study aimed to clarify the differences in patient-reported and physician-assessed manifestations of signs and symptoms of CS that prevent early diagnosis.
Methods
This single-center retrospective study included 52 patients with CS (16 with Cushing’s disease and 36 with adrenal CS). Upon clinical diagnosis, medical records were used to independently review the patient-reported and physician-assessed manifestations of typical (such as purple striae and proximal myopathy) and nonspecific features (such as hirsutism and hypertension). The correlations and differences between the patient-reported and physician-assessed manifestations were then analyzed.
Results
We observed a positive correlation between the total number of manifestations of nonspecific features reported by patients and those assessed by physicians, but not for typical features. Moreover, manifestations reported by the patients were less frequent than those assessed by physicians for typical features, leading to discrepancies between the two groups. In contrast, there were no differences in most nonspecific features between the patient-reported and physician-assessed manifestations. Notably, the concordance between patient-reported and physician-assessed manifestations of typical features was not associated with urinary free cortisol levels.
Conclusion
Regardless of disease severity, patients often do not complain of the typical features of CS that are crucial for formulating a diagnosis.
Introduction
Endogenous Cushing’s syndrome (CS) is caused by chronic and excessive glucocorticoid exposure. This occurs primarily due to adrenocorticotropic hormone (ACTH)-producing pituitary tumors (Cushing’s disease; CD) or cortisol-producing adrenal tumors (adrenal Cushing’s syndrome; ACS) [1]—and has a high mortality rate owing to cardiovascular disease, severe infection, and suicide, even when diagnosed and treated appropriately [1, 2]. Moreover, the prognosis is poor if the disease is not adequately treated or remains undiagnosed [2]. Therefore, early diagnosis and immediate intervention are important, as remission of CS due to surgical and pharmacological treatment can reduce the risk of mortality [3, 4].
CS is a rare disease with a prevalence of 57 per million individuals and an annual incidence of 3.2 per million, and its epidemiology is consistent across various regions worldwide [5, 6]. Most symptoms and signs of CS are common in general metabolic disorders, including obesity, hypertension, osteoporosis, and diabetes mellitus [7]. However, CS should be suspected if these symptoms appear as unusual features for their age [1, 8]. Consequently, the identification of CS is challenging and labor-intensive [1, 9, 10]. In fact, recent research revealed that a definitive diagnosis of CD (the most common form of CS), took an average of 3.8 ± 4.8 years from the onset of symptoms, and patients typically consulted 4.6 ± 3.8 medical professionals before this disease was identified [11]. Typical features of CS include symptoms of moon face, central obesity, or buffalo hump [12], which are similar to other symptoms such as primary obesity and therefore can lead to misdiagnosis. Furthermore, although purple striae or thin skin with an increased propensity for bruising are other typical features of CS [12], these attributes are not commonly acknowledged by the general population [1, 9].
Anzeige
Attempts have been made to diagnose CS early, including the development of scoring systems to estimate the pre-test probability of CS and facial image analysis software to diagnose the specific facial features of CS [13‐15]; however, these have not yet been used widespread or fully and the early diagnosis of CS remains dependent on the experience-based medical skills of the clinical staffs [16].
Additionally, although it is difficult for patients to recognize complex and nonspecific symptoms [17, 18], the significance of patients recognizing their illness has recently been reported for various diseases such as heart failure and malignant carcinoma [19‐21]. It is widely acknowledged that patients’ self-recognition can result in early detection of the disease, reduce its severity and recurrence, and enhance their quality of life [19]. In patients with endocrine diseases, there is increasing focus on issues surrounding self-recognition [22‐24]. For example, a previous study focusing on acromegaly reported a discrepancy between patient-reported and physician-reported manifestations and indicated that resolving this discrepancy could shorten the time to diagnosis [25].
Identifying CS may be challenging for primary care physicians who are yet to specialize. Therefore, endocrinologists with extensive experience in CS have often noticed that patients and these physicians struggle to identify the symptoms of CS; however, few comprehensive reports have focused on this issue or investigated whether patient-reported manifestations are consistent with physician-assessed symptoms of CS.
Therefore, this study aimed to investigate the unreported manifestations of CS among individuals referred to non-specialist healthcare providers, including primary care physicians, and to recognize potential challenges with the current diagnosis of CS with the goal of facilitating early detection.
Anzeige
Materials and methods
Patients, study design, and data collection
This single-center retrospective study was conducted to identify the discrepancies between patient-reported and physician-assessed symptoms and investigate the factors causing these differences.
From September 2004 to December 2022, 199 patients were referred to our department at a tertiary medical institution upon suspicion, evaluation, or follow-up for hypercortisolism. Of these patients, 92 were newly diagnosed with CS (36 with CD, 51 with ACS, and 5 with ectopic ACTH syndrome) based on the diagnostic guidelines [3, 8, 12], with a diagnosis confirmed by pathological evaluation after surgical resection [26]. However, 35 patients were excluded due to a lack of detailed clinical data on the manifestations at diagnosis. Similarly, we excluded individuals diagnosed with ectopic ACTH syndrome because of the lack of comprehensive information on symptoms reported by the patients and primary care physicians due to the rapid progression and severity of this disease. Therefore, 52 patients (16 with CD and 36 with ACS) were enrolled in this study.
Upon clinical diagnosis, the manifestations included in the comprehensive standardized interview at the time of diagnosis and those assessed by the physician through collaborative assessment with multiple board-certified endocrinologists as routine practice were independently reviewed from the medical records. We categorized these manifestations reviewed from the medical records into the following two categories based on the diagnostic guidelines including those of the Japan Endocrine Society: typical features, including moon face, central obesity or buffalo hump, purple striae of ≥1 cm, thin skin and easy bruising, and proximal myopathy; and nonspecific features (shown as atypical in Japan Endocrine Society’s guideline), including hypertension, menstrual abnormalities, acne, hirsutism, peripheral edema, glucose metabolism impairment, osteoporosis, pigmentation (which is not expected in patients with ACS), and mental abnormalities [1, 8, 12]. Central obesity or buffalo hump can also be observed in pseudo CS. However, in this study, features were classified as the same typical feature according to clinical guidelines [12, 27]. We also reviewed the biochemical findings, comorbidities, duration from the initial recognition of CS-related symptoms to diagnosis, and number of medical institutions visited before diagnosis.
The present retrospective study was performed in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Kobe University Hospital (Approval No. 1351). The patients had the option of an opt-out process, and all procedures were part of routine medical care.
Definition of patient-reported and physician-assessed manifestations
In the context of routine clinical care, physicians asked the patients about the presence or absence of manifestations and comorbidities (e.g., hypertension, menstrual abnormalities, glucose metabolism impairment, osteoporosis, and mental abnormalities), which were documented in the medical records. These reports in the medical records were defined as patient-reported manifestations in this study. In contrast, the manifestations and comorbidities of CS were assessed within several weeks after the patient was referred to our department for suspected CS. Additional diagnostic information on comorbidities is provided in the subsequent section. Physician-assessed manifestations were subsequently defined based on these findings.
Comorbidities of Cushing’s syndrome
All comorbidities were diagnosed according to the appropriate guidelines [28‐30]. For example, hypertension was diagnosed if patients were taking oral antihypertensive medication or had more than grade 1 hypertension (≥140/90 mmHg) in a treatment-naïve state [28]. Moreover, glucose metabolism impairment—including diabetes mellitus, impaired glucose tolerance, and impaired fasting glucose—was diagnosed based on the results of blood glucose levels during fasting and after a 75-g oral glucose tolerance test, as well as hemoglobin A1c (HbA1c) levels [29]. Patients taking medications for diabetes mellitus at the time of CS diagnosis were also categorized as having diabetes.
Other comorbidities included mental abnormalities, menstrual abnormalities, and the presence of osteoporosis. Mental abnormalities were defined as the use of anxiolytic medications, sleeping pills, or antidepressants prescribed by experienced psychologists, and menstrual abnormalities were defined as women with irregular menstrual cycles. Furthermore, the presence of osteoporosis was defined as bone mineral density (BMD) of <–2.5 standard deviations (SD) of the T-score of the lumbar vertebrae (L2–L4), femoral neck, or distal radius measured using dual-energy x-ray absorptiometry (DXA; Horizon A DXA System), and/or an experience of a fragility fracture [30]. As per the specifications of the measurement system employed, L1 was not included in the assessment. The Z-score was also employed as a diagnostic reference among young adults. Patients also diagnosed with osteoporosis who were receiving medications for this disease.
Hormone assay
In this study, blood samples were collected after an overnight fast. Subsequently, serum cortisol levels were measured using a chemiluminescent enzyme immunoassay [CLEIA] (TOSOH, Tokyo, Japan, RRID:AB_3099658) or enzyme immunoassay [EIA] (TOSOH, Tokyo, Japan, RRID:AB_3076600). Similarly, plasma ACTH levels were measured using a CLEIA (TOSOH, Tokyo, Japan, RRID:AB_3099657, or Siemens, Tokyo, Japan, RRID:AB_2909441) and EIA (TOSOH, Tokyo, Japan, RRID:AB_2783633). In both methods, the measurements showed good correlation and no conversion was required [31, 32].
Anzeige
Urinary free cortisol (UFC) levels were also measured using radioimmunoassays (RIA; TFB, Tokyo, Japan, RRID:AB_2894408) or chemiluminescent immunoassays (CLIA; Siemens, Tokyo, Japan, RRID:AB_2893154). Using the following formula, the UFC levels measured by RIA were then corrected to the value measured by CLIA: Y = 0.832X − 4.23 (Y = UFC levels using CLIA, X = UFC levels using RIA) [33].
Statistical analysis
All statistical analyses were performed using SPSS ver. 28.0 software (IBM Corp., Armonk, NY, USA). All continuous variables were analyzed using the Shapiro–Wilk normality test to confirm a normal distribution, whereas Fisher’s exact test was used to analyze categorical data. Between the two groups, differences in normally or non-normally distributed data were compared using the unpaired Student’s t-test or the Mann–Whitney U test, respectively.
Cohen’s kappa coefficient was used to describe the concordance between the patient-reported and physician-assessed manifestations. As previously reported [19, 20, 34], the concordance based on the value of Cohen’s kappa coefficient was rated as follows: 0.00–0.20 for “Slight,” 0.21–0.40 for “Fair,” 0.41–0.60 for “Moderate,” 0.61–0.80 for “Substantial,” and 0.81–1.00 for “Almost Perfect.” For correlation analysis between two variables of non-normally distributed data, we used Spearman’s rank correlation coefficient. Multivariate logistic regression analyses were then performed to investigate variables associated with the discrepancies between patient-reported and physician-assessed manifestations.
The results are presented as mean ± SD for normally distributed data and median [interquartile range] for non-normally distributed data, and differences were considered statistically significant when the P value was <0.05.
Anzeige
Results
Clinical characteristics of the patients
We included 52 patients diagnosed with CS in this study. Their clinical characteristics are presented in Table 1. Notably, this group consisted of 5 males and 47 females, with a mean age of 49.4 ± 15.8 years, median body mass index (BMI) of 23.0 [21.3–28.0] kg/m2, and median UFC level of 272.1 [126.0–435.0] µg/day. Of the CS patients, 16 had CD and 36 had ACS, which is consistent with epidemiological data on CS observed in Asians (including Japanese individuals); however, this differed from epidemiological data from Western countries [35, 36]. Regarding comorbidities, 43 patients were diagnosed with hypertension—of which 34 were prescribed antihypertensive medications—with a mean systolic blood pressure (BP) of 136.4 ± 21.5 mmHg and diastolic BP of 83.5 ± 15.0 mmHg. In addition, 44 patients were diagnosed with glucose metabolism impairment—of which, 20 were prescribed oral hypoglycemic agents and/or insulin—with a median fasting serum glucose level of 99.5 [87.3–116.5] mg/dL and median HbA1c level of 6.3% [5.7–7.4]. Moreover, 29 patients were diagnosed with osteoporosis, of which 4 were prescribed antiosteoporosis medication, with BMD T-score SDs of -1.54 ± 1.39, -1.76 ± 1.12, and -0.50 [-1.53–0.50] for the lumber spine, femoral neck, and distal radius, respectively. Notably, the UFC levels were higher in patients with CD than in those with ACS (412.6 [243.2–1,100.3] vs. 215.3 [114.0–387.8] µg/day); however, there were no significant differences attributed to sex, age, BMI, or the proportion of patients with respect to comorbidities, including hypertension and glucose metabolism impairment, between patients with CD and ACS.
Table 1
Clinical characteristics of the patients
Total
CD
ACS
CD vs. ACS P value
Number of men/women
5/47
1/15
4/32
1.00
Age (years)
49.4 ± 15.8
54.3 ± 19.2
47.2 ± 13.8
0.14
BMI (kg/m2)
23.0 [21.3–28.0]
24.7 [22.2–30.0]
22.8 [20.8–26.4]
0.17
Midnight F (µg/dL)
20.1 [16.0–23.5]
20.2 [13.9–24.7]
20.1 [16.9–23.0]
0.97
F after LDDST (μg/dL)
21.2 ± 6.9
24.2 ± 10.1
19.7 ± 4.2
0.11
UFC (μg/day)
272.1 [126.0–435.0]
412.6 [243.2–1,100.3]
215.3 [114.0–387.8]
0.02
Basal ACTH (pg/mL)
2.0 [0.0–53.9]
83.2 [57.4–169.9]
0.0 [0.0–2.1]
<0.01
Systolic BP (mmHg)
136.4 ± 21.5
140.5 ± 20.7
134.6 ± 21.8
0.36
Diastolic BP (mmHg)
83.5 ± 15.0
83.1 ± 14.3
83.6 ± 15.5
0.90
Use of antihypertensive drugs, n (%)
34 (65)
13 (81)
21 (58)
0.13
FSG (mg/dL)
99.5 [87.3–116.5]
110.0 [102.0–142.8]
92.5 [83.3–114.3]
0.01
HbA1c (%)
6.3 [5.7–7.4]
6.8 [5.9–8.6]
6.0 [5.7–7.1]
0.08
Use of OHA and/or insulin, n (%)
20 (38)
9 (56)
11 (31)
0.12
LS BMD T-score (SD)
−1.54 ± 1.39
−1.00 ± 1.38
−1.79 ± 1.35
0.07
LS BMD Z-score (SD)
−0.78 ± 1.37
0.13 ± 1.11
−1.20 ± 1.28
<0.01
FN BMD T-score (SD)
−1.76 ± 1.12
−1.73 ± 1.54
−1.78 ± 0.88
0.92
FN BMD Z-score (SD)
−0.79 ± 1.01
−0.39 ± 1.10
−0.99 ± 0.92
0.10
Radius BMD T-score (SD)
−0.50 [−1.53–0.50]
−0.30 [−2.50–0.40]
−0.60 [−1.30–0.60]
0.79
Radius BMD Z-score (SD)
0.60 [−0.60–1.50]
1.50[−0.60–1.80]
0.50[−0.50–1.00]
0.33
Use of antiosteoporosis drugs, n (%)
4 (8)
1 (6)
3 (8)
1.00
Time to diagnosis (months)
44.0 [13.3–125.3]
43.0 [15.0–128.3]
47.5 [12.5–125.3]
0.87
Number of medical institutions before diagnosis
3.0 [2.0–5.0]
3.0 [2.0–5.0]
3.0 [3.0–5.8]
0.23
The results are presented as mean ± SD for normally distributed data and median [interquartile range] for non-normally distributed data
CD Cushing’s disease, ACS adrenal Cushing’s syndrome, BMI body mass index, F cortisol, LDDST low-dose dexamethasone suppression test, UFC urinary free cortisol, ACTH adrenocorticotropic hormone, BP blood pressure, FSG fasting serum glucose, HbA1c hemoglobin A1c, OHA oral hypoglycemic agents, BMD bone mineral density, LS lumber spine, FN femoral neck
The median duration from the patients’ initial recognition of CS-related manifestations to diagnosis was 44.0 [13.3–125.3] months, and it took more than 3 years to diagnose CS in 30 patients (58%). Furthermore, the median number of medical facilities visited by patients before diagnosis was 3.0 [2.0–5.0]; however, there were no significant differences in the duration or number of medical institutions between patients with CD and those with ACS.
Frequency and concordance between patient-reported and physician-assessed CS-related manifestations
Each manifestation reported by a patient or assessed by a physician is shown vertically for individual cases in Fig. 1. Compared with nonspecific features, typical features appeared to not be reported by the patients but were only assessed by the physicians. In addition, compared to nonspecific features, there were fewer cases in which the manifestations reported by the patients were consistent with those assessed by physicians for typical features.
Fig. 1
Consistency between patient-reported and physician-assessed manifestations for each individual case. The consistencies or discrepancies between patient-reported and physician-assessed manifestations are shown. Vertical lines represent manifestations in individual patients. CD Cushing’s disease, ACS adrenal Cushing’s syndrome
Consistent with the impact of these visually distinctive presentations shown in Fig. 1, no correlation was observed in the number of typical features between patient-reported and physician-assessed manifestations (r = –0.20, P = 0.16) (Fig. 2A), whereas a positive correlation was found for nonspecific features (r = 0.62, P < 0.01) (Fig. 2B). Moreover, the total number of patient-reported manifestations of typical features was lower than that of physician-assessed manifestations (1.0 [0.0–2.0] vs. 3.5 [3.0–4.0], P < 0.01), and four of the five typical features were reported less frequently by patients than by physicians, except for proximal myopathy (Table 2A). According to Cohen’s kappa coefficient, the concordance between patient-reported and physician-assessed manifestations was marked as “Fair” to “Slight,” indicating a discrepancy for all typical features. Similarly, the total number of patient-reported manifestations of nonspecific features was also lower than that in physicians (2.5 [2.0–3.0] vs. 4.0 [3.0–5.0], P < 0.01). However, except for glucose metabolism impairment or osteoporosis, there were no differences in the frequencies of nonspecific features between patient-reported and physician-assessed manifestations, and the concordance of the nonspecific features between the patient-reported and physician-assessed manifestations was “Almost perfect” for menstrual abnormality and “Substantial” for mental abnormality and hypertension, whereas that for glucose metabolism impairment and osteoporosis was “Fair.” This suggests that the discrepancy between patient-reported and physician-assessed manifestations was more significant for typical than for nonspecific features. However, no differences in these discrepancies were observed between patients with CD and those with ACS (Table 2B, C).
Fig. 2
Correlation between the total number of patient-reported and physician-assessed manifestations. Correlations between the total number of patient-reported and physician-assessed manifestations are shown for typical (A) and nonspecific features (B). CD is plotted by ×, and ACS is plotted by ○. The Spearman’s rank correlation coefficients and P value are presented. CI confidence interval, CD Cushing’s disease, ACS adrenal Cushing’s syndrome
Table 2
Frequencies of patient-reported and physician-assessed manifestations and their concordance. A. All patients (n = 52). B. Patients with CD (n = 16). C. Patients with ACS (n = 36)
Patient-reported
Physician-assessed
P value of Fisher’s exact test
Concordance with Cohen’s kappa coefficient
A
Typical features
Moon face, n (%)
20 (39)
48 (92)
<0.01
Slight
Central obesity or buffalo hump, n (%)
13 (25)
44 (85)
<0.01
Slight
Purple striae, n (%)
3 (6)
15 (29)
<0.01
Fair
Thin skin and easy bruising, n (%)
15 (29)
43 (83)
<0.01
Slight
Proximal myopathy, n (%)
21 (40)
27 (52)
0.33
Slight
Nonspecific features
Hypertension, n (%)
39 (75)
43 (83)
0.47
Substantial
Menstrual abnormalities, n (%)
11 (21)
11 (21)
1.00
Almost perfect
Acne, n (%)
7 (14)
13 (25)
0.21
Moderate
Hirsutism, n (%)
3 (6)
10 (19)
0.07
Moderate
Peripheral edema, n (%)
24 (46)
28 (54)
0.56
Fair
Glucose metabolism impairment, n (%)
24 (46)
44 (85)
<0.01
Fair
Osteoporosis, n (%)
7 (14)
29 (56)
<0.01
Slight
Pigmentation, n (%)
0 (0)
5 (10)
0.06
–
Mental abnormalities, n (%)
17 (33)
17 (33)
1.00
Substantial
B
Typical features
Moon face, n (%)
6 (38)
14 (88)
0.01
Slight
Central obesity or buffalo hump, n (%)
6 (38)
15 (94)
<0.01
Slight
Purple striae, n (%)
2 (13)
4 (25)
0.56
Moderate
Thin skin and easy bruising, n (%)
4 (25)
13 (81)
0.06
Slight
Proximal myopathy, n (%)
8 (50)
8 (50)
1.00
Slight
Nonspecific features
Hypertension, n (%)
16 (100)
15 (94)
0.78
Slight
Menstrual abnormalities, n (%)
5 (31)
5 (31)
1.00
Almost perfect
Acne, n (%)
1 (6)
3 (19)
0.56
Moderate
Hirsutism, n (%)
2 (13)
4 (25)
0.56
Moderate
Peripheral edema, n (%)
8 (50)
10 (63)
0.56
Slight
Glucose metabolism impairment, n (%)
10 (63)
15 (94)
0.14
Slight
Osteoporosis, n (%)
4 (25)
9 (56)
0.15
Slight
Pigmentation, n (%)
0 (0)
5 (31)
0.14
–
Mental abnormalities, n (%)
5 (31)
6 (38)
0.78
Moderate
C
Typical features
Moon face, n (%)
14 (39)
34 (94)
<0.01
Slight
Central obesity or buffalo hump, n (%)
7 (19)
29 (81)
<0.01
Slight
Purple striae, n (%)
1 (3)
11 (31)
<0.01
Slight
Thin skin and easy bruising, n (%)
11 (31)
30 (83)
<0.01
Slight
Proximal myopathy, n (%)
13 (36)
19 (53)
0.24
Slight
Nonspecific features
Hypertension, n (%)
23 (64)
28 (78)
0.30
Substantial
Menstrual abnormalities, n (%)
6 (17)
6 (17)
1.00
Almost perfect
Acne, n (%)
6 (17)
10 (28)
0.40
Moderate
Hirsutism, n (%)
1 (3)
6 (17)
0.11
Fair
Peripheral edema, n (%)
16 (44)
18 (50)
0.81
Fair
Glucose metabolism impairment, n (%)
14 (39)
29 (81)
<0.01
Fair
Osteoporosis, n (%)
3 (8)
20 (56)
<0.01
Slight
Pigmentation, n (%)
0 (0)
0 (0)
–
–
Mental abnormalities, n (%)
12 (33)
11 (31)
1.00
Almost perfect
The frequencies of patient-reported and physician-assessed manifestations were compared using Fisher’s exact test. The concordance between patient-reported and physician-assessed manifestations was evaluated with Cohen’s kappa coefficient, and its coefficients were defined as follows: 0.00–0.20 for “Slight,” 0.21–0.40 for “Fair,” 0.41–0.60 for “Moderate,” 0.61–0.80 for “Substantial,” and 0.81–1.00 for “Almost perfect”
CD Cushing’s disease, ACS adrenal Cushing’s syndrome
Anzeige
We performed logistic regression analyses using UFC to investigate whether excess cortisol levels influenced the discrepancy between patient-reported and physician-assessed manifestations. Notably, we observed no association between UFC levels and discrepancies between patient-reported and physician-assessed manifestations in the univariate or multivariate logistic regression analyses adjusted for sex and age (Table 3A). In addition, no association was observed after adjusting for other variables such as BMI and disease duration. Similarly, we found that the serum cortisol levels after the low-dose dexamethasone suppression test (LDDST) were not associated with discrepancies between patient-reported and physician-assessed manifestations (Table 3B). Thus, these disparities were shown to be insignificant when directly related to the severity of CS.
Table 3
Logistic regression analyses of the discrepancies between the patient-reported and physician-assessed manifestations. A. Variables associated with UFC levels. B. Variables associated with serum cortisol levels after the LDDST
Univariate
Multivariate 1 (sex- and age-adjusted)
Multivariate 2 (BMI-adjusted)
Multivariate 3 (disease duration-adjusted)
A
Moon face
1.000 (0.999–1.001)
1.000 (0.999–1.001)
1.000 (0.998–1.002)
1.000 (0.999–1.001)
Proximal myopathy
1.000 (0.999–1.001)
1.000 (0.999–1.001)
1.000 (0.998–1.001)
1.000 (0.998–1.001)
Thin skin and easy bruising
1.000 (0.998–1.001)
1.000 (0.999–1.001)
1.000 (0.999–1.001)
1.000 (0.998–1.001)
Central obesity or buffalo hump
1.001 (1.000–1.003)
1.001 (1.000–1.003)
1.001 (1.000–1.003)
1.001 (1.000–1.003)
Purple striae
1.000 (0.999–1.002)
1.000 (0.998–1.002)
1.001 (0.999–1.003)
1.000 (0.999–1.002)
B
Moon face
0.998 (0.919–1.084)
0.999 (0.919–1.086)
1.000 (0.920–1.088)
0.997 (0.918–1.082)
Proximal myopathy
1.007 (0.925–1.097)
1.007 (0.924–1.097)
1.007 (0.925–1.097)
1.006 (0.924–1.096)
Thin skin and easy bruising
1.022 (0.939–1.112)
1.018 (0.934–1.109)
1.023 (0.940–1.113)
1.019 (0.937–1.109)
Central obesity or buffalo hump
0.979 (0.890–1.078)
0.978 (0.865–1.105)
0.981 (0.875–1.099)
0.978 (0.887–1.078)
Purple striae
0.998 (0.919–1.084)
0.999 (0.919–1.086)
1.000 (0.920–1.088)
0.997 (0.918–1.082)
The results are presented as odds ratios (95% confidence intervals)
UFC urinary free cortisol, BMI Body Mass Index, LDDST low-dose dexamethasone suppression test
Discussion
In the present study, we highlight the challenges associated with the diagnosis of CS—a condition resulting from excessive glucocorticoid exposure—and elucidate the divergence between patient-reported and physician-assessed manifestations. Thus, this study may aid in the early detection of CS by identifying symptoms that patients are unable to recognize based on the disparities between patient-reported and physician-assessed manifestations of CS.
In this study, the number of patient-reported manifestations of both typical and nonspecific features was lower than that of physician-assessed manifestations, suggesting that CS symptoms may have been overlooked by relying solely on patient reports. Additionally, analysis of the concordance between patient-reported and physician-assessed manifestations revealed a tendency for these manifestations to be inconsistent for both typical and nonspecific features, with a tendency to be more significant for typical features. Furthermore, the UFC and serum cortisol levels after the LDDST, which represent the severity of CS, were not associated with the concordance of manifestations between patients and physicians, suggesting that even in cases of severe CS, patients may not recognize their symptoms. These findings imply that typical features, which are essential for diagnosing CS, may be difficult for patients to recognize and poorly identified or conveyed to patients by non-specialist physicians, who are typically the first to interact with individuals with CS. The importance of educating healthcare providers such as primary care physicians, family physicians and gynecologists for early diagnosis of CS should be highlighted.
According to a previous report on the diagnostic history of 176 patients with CD, 83% of the patients visited their family physician for manifestations such as weight gain and hypertension, while 46% visited a gynecologist for menstrual abnormalities before the diagnosis of CD [11]. Thus, the typical features of CS were not recognized. The examination may reveal nonspecific features. However, individuals who are non-specialists may not recognize these features as indications of CS. Therefore, patients are often unaware of the potential complications associated with CS. This is consistent with the results of our study, in which patient-reported and physician-assessed manifestations were more consistent for hypertension and menstrual abnormalities than for other manifestations such as typical features, glucose metabolism impairment, and osteoporosis. This makes diagnosis challenging as non-specialist physicians and, more prominently, patients may not recognize the full range of symptoms associated with CS, especially the typical features with high diagnostic value. In addition, older patients diagnosed with CS present with a lower BMI and waist circumference than younger patients [37], and they typically do not exhibit symptoms commonly associated with CS such as skin alterations, depression, hair loss, hirsutism, and reduced libido. These findings may further complicate the diagnosis of CS in elderly patients.
By evaluating only the patient-reported manifestations, it appears that manifestations such as peripheral edema and proximal myopathy were more common. Possibly, these symptoms were not considered features of CS by physicians, in comparison to the degree of symptoms experienced by the patients. However, this may not necessarily imply diminishing the significance of the patient’s signs and symptoms, as these manifestations can be considered as the unidentified complaints and may result in a postponement of the diagnosis of CS. Patients may be experiencing symptoms that physicians do not perceive, indicating the importance of interview and physical examination. Further investigation is needed to elucidate underlying factors.
Considering the rarity of CS, it is crucial to suspect and diagnose the condition based on clinical symptoms and perform the appropriate screening tests without over- or under-screening [7]. Although CS screening in patients with diabetes mellitus and hypertension has been reported to lead to a diagnosis in only 0–0.7% and 0.1–0.5% of these patients, respectively [38‐41], it is ineffective in terms of false positives and cost [9]. Therefore, patients with typical features that are highly specific for CS, such as purple striae, easy bruising, and proximal myopathy [1, 8, 12], as well as those with obesity, diabetes mellitus, or hypertension in combination with these features, should be screened for CS [7, 27]. However, our results suggest that these symptoms are unlikely to be self-recognized. Therefore, the appropriate screening measures must be implemented to establish an early and effective diagnosis of CS.
In these situations, it is crucial for physicians to utilize their knowledge and experience to suspect CS based on symptoms such as typical features [10]. It has been reported that years of clinical experience in endocrine practice can contribute to the estimation of the pre-test probability of CS [16]. In contrast, non-specialists are less likely to encounter patients with CS in their lifetime, which can make it difficult to properly suspect CS [9]. From this perspective, it is of utmost importance that family physicians and general internists are knowledgeable regarding the manifestations that require screening for CS, as early diagnosis of this uncommon and severe condition is crucial [11]. Therefore, it is important for physicians who routinely treat patients presenting with common symptoms such as obesity, diabetes mellitus, and hypertension to meticulously interview and observe for any indicators of CS, even if the patient does not recognize them. Failure to adopt an appropriate tone in these situations may cause the disease to become undetectable.
In rare disorders such as CS, in addition to enhancing public recognition of the disease, the appropriate sharing of information and provision of specialized care in clinical practice remain important issues [42]. Early identification of such rare diseases can be achieved by promoting an understanding of the disease and its symptoms among family, friends, and patients who may be the first to recognize the signs and symptoms in an individual. In fact, in a questionnaire survey of 340 patients with CS across 30 countries, the diagnosis of CS was made in 5.6% of cases by the patients themselves and in 0.9% by their family or friends [43]. In the present study, we found that it took more than 3 years to diagnose CS in 58% of the cases. If CS and its symptoms are popularized among the public, the typical features of CS could be more readily reported to physicians and the time to diagnosis might be shorter. Furthermore, a primary care physician who is well-educated and knowledgeable is crucial in ensuring that the concerns of such individuals are not overlooked.
This study has some limitations. First, this single-center retrospective study included a relatively small sample size with few male patients. Second, CD and ACS have different pathologies; therefore, the frequencies of several CS-related manifestations will differ depending on their subtypes [3, 44]. However, in this study, there was no difference in the discrepancies between patient-reported and physician-assessed manifestations in patients with CD or ACS. Nonetheless, it is crucial that comprehensive research is conducted in larger patient populations with a focus on employing methods that accurately reflect the pathophysiology of CD and ACS. Third, patient reports may be inaccurate in terms of onset and duration because they depend on the patient’s memory. Fourth, the endocrinologists who examined the patients differed, which may have affected the presence or absence of physician-assessed manifestations. Finally, this study investigated the differences between the manifestations reported by patients and those assessed by endocrinologists, although the evaluations conducted by primary care physicians, which are crucial for the early detection of CS, were not available. Future research is needed to investigate the differences in recognizing manifestations between non-specialist physicians and endocrinologists with extensive experience in CS and to examine the changes before and after education for these non-specialists to determine if they can lead to earlier diagnosis of CS.
In conclusion, endocrinologists have been shown to be aware of CS-related symptoms, especially typical features, whereas patients do not recognize these manifestations, even when the disease is severe. Therefore, the key to the early diagnosis and treatment of CS is a more proactive approach of questioning and examining patients suspected of having the disease.
Acknowledgements
We thank all the physicians and medical assistants who were involved in this study. We are grateful to all the laboratory members for their excellent discussions and fruitful suggestions. We also thank Editage (www.editage.jp) for English language editing.
Compliance with ethical standards
Conflict of interest
The authors declare no competing interests.
Ethics approval
This study conformed to the Declaration of Helsinki guidelines and was approved by the Ethics Committee of Kobe University Hospital (Approval No. 1351).
Informed consent
Informed consent was obtained from all the participants using an opt-out approach.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Activating mutation in Ubiquitin-specific peptidase (USP8) is identified to enhance cell proliferation and adrenocorticotropic hormone (ACTH) secretion from corticotroph pituitary adenoma. We investigated the USP8 variant status in a population of Iranian people with functional corticotroph pituitary adenoma (FCPA). Moreover, a systematic review was conducted to thoroughly explore the role of USP8 variants and the related pathways in corticotroph adenomas, genotype-phenotype correlation in USP8-mutated individuals with FCPA, and the potential role of USP8 and epidermal growth factor receptor (EGFR) as targeted therapies in PFCAs.
Methods
Genetic analysis of 20 tissue samples from 19 patients with PFCAs was performed using Sanger sequencing. Moreover, a systematic literature review was performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. PubMed, Scopus, web of Sciences, and Cochrane databases were searched. The last search was performed on 20 September 2023 for all databases.
Results
In our series, we found two somatic mutations including a 7-bp deletion variant: c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant: c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The Systematic review indicated USP8 variant in 35% of corticotroph adenomas, with the highest frequency (25%) in 720 code regions, p. Pro720Arg. Data regarding the impact of USP8 mutational status on clinical characteristics and outcomes in FCPAs are inconsistent. Moreover, Pasireotide as well as inhibitors of EGFR such as Gefitinib and Lapatinib, as well as USP8 inhibitors including -ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2, 3-dicarbonitrile, DUBs-IN-2, and RA-9 indicated promising results in treatment of corticotroph adenomas.
Conclusion
Although the USP8–EGFR system has been identified as the main trigger and target of corticotroph tumorigenesis, more precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.
Pituitary corticotroph adenoma accounts for 68% of endogenous hypercortisolism [1]. Prolonged exposure to high cortisol levels is associated with a variety of long-term complications, impaired quality of life, and increased mortality [2]. Transsphenoidal surgical excision is the treatment of choice. However, curative surgery is challenging with the initial remission rate of 65–85% and a high recurrence rate [3, 4].
The majority of functional corticotroph adenomas (FCAs) are sporadic. Although the genetic background is not well-established, potential candidate genes are proposed for tumor initiation and progression [5]. Hotspot mutations in ubiquitin-specific peptidase (USP8) are reported in 11–62% of sporadic corticotroph adenomas [6,7,8]. USP8 is a deubiquitinating enzyme that plays an important role in enhancing cell proliferation and regulating cell cycle [9]. The mutant USP8 was found to activate the epidermal growth factor receptor (EGFR) signaling pathway ultimately promoting adrenocorticotrophic hormone (ACTH) secretion [6]. Moreover, overexpression of EGFR and its signaling pathway components in pituitary corticotroph adenoma was reported [10]; and found to be positively associated with ACTH and cortisol levels as well as tumor recurrence [10]. These outcomes suggest that USP8 and EGFR are promising biomarkers for prediction of recurrence and can be used as targeted therapy.
Thus, we conducted a study to examine the USP8 and ubiquitin-specific peptidase 48 (USP48) variations in a group of Iranian people with Cushing’s disease (CD) and carried out a systematic review of the literature regarding the USP8/EGFR and their potential role in the clinical outcomes and targeted therapy in CD.
Methods
Case series
Study population
Paraffin-embedded blocks of pituitary tumor tissue from 19 patients with ACTH-secreting pituitary adenoma who underwent transsphenoidal surgery (TSS) between 2011 and 2019 were examined. The diagnosis of CD was based on clinical features and biochemical criteria [11]. The patients clinically suspected to CD were asked to collect urine free cortisol (UFC) in two separated times and underwent overnight dexamethasone suppression test (ODST). After confirmation of ACTH-dependent Cushing’s syndrome using measurement of ACTH level, a high-dose dexamethasone suppression test (HDDST) was performed to confirm the pituitary source of hypercortisolism. Patients with equivocal results or those with pituitary tumors less than 6 mm in size were undergone inferior petrosal sinus sampling (IPSS). Patient with clinical, biochemical, and radiological evidences of CD were undergone TSS. And eventually, corticotroph adenoma was confirmed using immunohistochemically staining of tumor tissue in all patients. The study was approved by the IUMS Research Ethics Committee (IR.IUMS.REC.1398.082). It was carried out under the declaration of Helsinki and the International Conference on Harmonization of Good Clinical Practice (ICH-GCP) guidelines, and informed consent was obtained from all patients.
DNA extraction and Sanger sequencing
A 10-µm thick section of formalin-fixed and paraffin-embedded (FFPE) tissue per sample was used for genomic DNA extraction. A molecular test was performed by amplification of USP8 and USP48 hotspot exons (exon 14 and exon 10, respectively) using conventional polymerase chain reaction (PCR). USP8 was amplified by two primer pairs; USP8_F1: AGCAGAATACTTTGGAGTGATTTC and USP8_R1: TTTGGAAGGTTCCCTATCCC with 251 bp product, USP8_F2: ACCCCTCCAACTCATAAAGC and USP8_R2: GAGTAGAAACTTTGAAATACAGCAC, with 220 bp product. A 240 bp fragment of USP48 was produced using; USP48_F: CCCGCTAAAGAATAAACAAACTC and USP48_R: GCATTCTAAAACATTTGCCTGC. PCR was done in 25 µl final volume (Ampliqon 2x PCR Mix) containing 0.5 µM of each primer and 30 ng of genomic DNA for 35 cycles (94 °C for 20 s, annealing 60 °C for 20 s and extension 72 °C for 20 s). The quality of PCR products was assessed by 2% agarose gel electrophoresis. Bidirectional Sanger sequencing was performed on an ABI DNA Analyzer (Applied Biosystems), The PCR primers were also used in the sequencing reaction. CodonCode Aligner software was used to analyze hotspot exome sequencing. Sequencing data quality was evaluated using Sanger electropherograms of both forward and reverse strands. The identified somatic mutations were analyzed in DNA taken from whole blood samples, but germline mutation was not detected.
Systematic review
Overview of the systematic literature review
We performed a systematic review of the literature to identify all published papers that reported the frequency of the USP8 variant and the related pathways in corticotroph pituitary adenomas, detailed clinical presentation and outcomes of patients with and without USP8 mutation and examined the USP8 and EGFR as targeted therapy.
Search strategy
We searched the PubMed, Scopus, web of Sciences, and Cochrane databases. The date of the last search was 20 September 2023 for all databases. We did not apply any language restrictions. Search terms included: “Cushing disease”, “Cushing’s disease”, “Corticotroph adenoma”, “Cushing adenoma”, “Client Cushing disease”, “Atypical corticotroph tumor”, “Corticotroph carcinoma”, “Normal pituitary”, “Corticotroph adenoma”, “Corticotroph Tumor”, “Pituitary ACTH Hypersecretion”, “ACTH-Secreting Pituitary Adenoma”, “Mutation”, “Germline mutation”, “Sporadic mutation”, USP8, “ubiquitin specific peptidase 8”, USP48, “ubiquitin specific peptidase 48”, “Epidermal growth factor”, EGF, “Epidermal growth factor receptor” EGFR, Biomarker.
Inclusion and exclusion criteria
All published papers including original articles, case reports, and case series were included in this systematic review provided that they have reported the frequency of USP8 variant or EGFR expression in corticotroph pituitary adenomas, compared the clinical presentation and outcomes of patients with and without USP8 variant, or examined USP8 or EGFR as treatment targets in CD. Studies applying any type of tissue namely resected human pituitary adenoma tissue, primary cell cultures, cell lines, and transfected cells were included. Articles were excluded if they included different types of pituitary tumors and did not separately analyze corticotroph adenomas, or if they were written in any language other than English.
Results
Case series
Baseline characteristics of the participants
This study included 19 patients of whom 63% (n = 12) were women. They aged between 17 and 65 years. Baseline cortisol ranged between 20 and 43 mic/dl. The ACTH level ranged between 34 and 164 pg/ml. The basal UFC ranged between 316 and 1153 mic/24 h. All patients presented with micro-adenoma except for two patients, one man and one woman (supplementary Table 1).
Frequency of USP8 gene variants
Sanger sequencing of 20 CD tumors revealed two heterozygous pathogenic variants in 2 samples: the 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3 was found in one patient; another patient showed the missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. The pathogenic variants were found only in tumor tissue. Targeted sequencing (exon 10) of USP48 did not detect any pathogenic variant. The somatic variations in our study are in the catalytic conserved domain of USP8 protein and lead to disruption of the interaction between USP8 catalytic domain and 14-3-3 protein (Fig. 1).
Fig. 1
Sanger sequencing of pathogenic variants in USP8 hotspot exon. (A, B) bi-directional sequencing of heterozygous missense variant, c.2159 C > G, in tissue sample, (C) A Sanger sequencing chromatogram of the blood sample detected no germline c.2159 C > G mutation. (D) Sanger sequencing chromatograms confirm the presence of heterozygous deletion (c.2151_2157delCTCCTCC) in tissue sample of patient II
All patients achieved biochemical and structural cures after surgery except for one man and one woman who suffered from persistent disease because the tumors were not completely resected due to invasion into the cavernous sinus. They underwent radiotherapy after surgery. These two patients did not show the USP8 variant. Moreover, one man without evidence of the USP8 variant and the two women with the USP8 variant presented with recurrence after initial remission. They presented with micro-adenoma before surgery (supplementary Table 1).
Systematic review
The search yielded 1459 initial results. Upon removing the duplications (n = 410), 1049 studies were reviewed based on the relevancy of their titles and abstracts. Having excluded 957 articles, 92 studies were selected for full-text review. After an in-depth review, 31 articles were selected based on the inclusion and exclusion criteria. A PRISMA diagram detailing the search results is shown in Fig. 2.
Fig. 2
Flow diagram of literature search and study selection
In this systematic review we extracted the information regarding the USP8 variant and the EGFR system in corticotroph adenomas. The USP8 variant was found in 460 individuals with FCPA accounting for 35% of the population included in the related published series (Table 1). Moreover, the highest frequency of missense mutation was found in the 720 code region, p.Pro720Arg (25%), followed by 19% in p.Ser718Pro (Fig. 3). In addition, the frequency of frame-shift and in-frame deletion observed in p.Ser718del and p.Ser719del was 12% and 11%, respectively (Fig. 3).
USP8 variants and the related pathways in corticotroph adenomas
In a study of 42 patients with corticotroph adenomas, USP8 variants were as follows: p. P720R (found in five patients), p. S718P (found in two patients), p. P720Q (found in two patients), p. S716Y (found in one patient), and p. S716F (found in one patient) [12]. Another genetic study demonstrated mutated USP8 deubiquitinating EGFR more effectively than wild type USP8. Some variants namely p.S718del, p.718SP, and p.P720R have higher deubiquitinated activity, while others including p.S718C, p.L713R, and p.Y717C showed similar activity compared to the wild type. These variants have been shown to increase the catalytic and proteolytic activity of USP8, which ultimately leads to the activation of the EGFR pathway. High EGFR levels, in turn, stimulate POMC gene transcription and increase plasma ACTH levels [6]. In the study of Seata, the USP8 variant was found in 23% of corticotroph adenomas. The variants were heterozygous, including p.S718, p.P720 (n = 18), p.S719del (n = 10), and p.P720_723 del (n = 1). Moreover, a comparison of 5 USP8 mutant vs. 34 wild-type specimens indicated different gene expression profile. According to the results, 2 genes involving in EGF signaling, CMTM8 (CKLFlike MARVEL transmembrane domain containing 8) and MAPK15 (mitogen-activated protein kinase 15), were upregulated in USP8 variant carriers [13]. Bujko et al. found USP8 mutation in 31.3% of patients with FCA and silent corticotroph adenomas (SCA). In-frame and missense mutations were p.Ser718del (7 patients), p.Pro720Arg (5 patients), p.Ser718Pro (2 patients) and p.Pro720Gln (one patient). USP8-mutated adenomas showed higher level of POMC, CDC25A, MAPK4 but lower level of CCND2, CDK6, CDKN1B than USP8-wild-type tumors [14].
Another study investigated the molecular pathogenesis of the spectrum of corticotroph adenomas, including CD, SCA, CCA (Crooke cell adenomas), and ACTH-producing carcinoma using whole exome sequencing. The patients with ACTH-producing carcinoma showed the highest number of variants in USP8, EGFR, TP53, AURKA, CDKN1A, and HSD3B1 genes. The USP8 variant was found in c.2159 C > G (p.Pro720Arg) and was positively correlated to the tumor size. However, the USP8 variant was not present in any of the patients with CD [15].
Martins and colleagues conducted a study to investigate the USP8 variant and its contribution to gene expression of cell cycle regulators including P27/CDKN1B, CCNE1, CCND1, CDK2, CDK4, and CDK6 in 32 corticotroph adenoma. They identified variants in certain hotspot exons, namely p.720R (found in five patients), p.S718del (found in three patients), p.S718P (found in one patient), and p.S719_T723del (found in one patient). Moreover, there was no difference regarding the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [16]. Another study investigating the USP8 variants and genes involved in cell cycle regulation observed USP variants including p. P720R (n = 8), p.720Q (n = 2), p. S718SP (n = 2), and an in-frame deletion at the 719 position (n = 8). However, USP8-mutated tumors showed lower CDKN1B, CDK6, CCND2 and higher CDC25A expression. They also observed a significantly lower level of p27 in USP8-mutated tumors as compared to the wild-type ones [17].
A comprehensive study determined the presence of EGFR at the protein and mRNA levels in different pituitary adenomas. The highest incidence of EGFR expression was found in corticotroph adenomas. The corticotroph adenomas with EGFR expression did not show p27 immunoreactivity [18].
DNA methylation regulates promoter activities. The study by Araki et al. identified a novel regulatory region in the human POMC gene which functions as a second promoter. Moreover, they indicated that this region is highly methylated in SCAs and highly demethylated in FCAs and ectopic ACTH-secreting tumors. They also demonstrated demethylation of the second promoter is associated with aggressive features of FCAs independent of the USP8 variant or EGFR signaling. In contrast, the first promoter was highly demethylated in USP8-mutated FCAs [19]. Weigand et al. indicated that p27/kip1 protein expression significantly decreased in USP8-mutated adenomas compared to the wild-type USP8 tumors. Moreover, higher expression of heat shock protein 90 (HSP90) and an increase in the phosphorylation of the transcription factor CREB was observed in mutated-USP8 adenomas [20]. Achaete-scute complex homolog 1 (ASCL1) plays an important role in cell proliferation and also regulates POMC in the cell line. In a recent study, genetic analysis of corticotroph adenomas using RNA-seq and IHC showed an increase in ASCL1expression and protein levels in both mutated and wild type USP8 among CD patients [21].
Genotype-phenotype correlation in USP8-mutated individuals with functional corticotroph adenoma
Sanger sequencing of 120 FCPAs indicated the somatic USP8 variant more frequently in women than in men, which was associated with a significant lower size and higher ACTH level. Moreover, compared to the wild-type tumors, the USP8-mutated ones display a higher level of EGFR expression with a higher staining intensity. The initial remission rate and the recurrence rate in patients initially receiving remission were comparable in both groups [7]. Another study of patients with 134 functional and 11 silent corticotroph adenomas demonstrated somatic USP8 variants only in functional adenomas, none of them occurred in silent adenomas. The USP8 variant in adults was associated with lower age, and predominantly occurred in women. Moreover, the presence of USP8 variant was inversely associated with remission [22]. In a cohort of 42 pediatric patients with FCA, five different USP8 variants (three missenses, one frame-shift, and one in-frame deletion) were identified. None of the patients were found to have gremlin USP8 variants. Patients with somatic USP8 variant were significantly older than those with wild-type USP8. However, there was no significant difference in terms of preoperative hormonal profile and tumor invasiveness between the two groups. However, somatic USP8 mutated patients showed a higher rate of recurrence after a mean follow-up of 34.7 months [23].
In a cohort of 48 FCA, patients with the USP8 variant had significantly higher levels of preoperative urine-free cortisol (UFC). But there was no difference in preoperative ACTH and cortisol level between USP8-mutated and wild-type groups. Although initial remission rate was similar in both groups, patients with USP8 variant revealed a significantly higher rate of recurrence within 10 years follow-up, with a significantly shorter time to recurrence [24]. USP8-mutated FCA patients presented with a significantly larger size of adenoma in a retrospective study. But preoperative hormonal profile and the remission rate were similar in both groups [16]. Retrospective genetic analysis of 92 FCA patients indicated that the USP8 variant was significantly higher in women than men. There was no significant difference in preoperative hormonal profile and tumor size between USP8-mutated and wild-type groups. USP8-mutated carriers were more likely to achieve surgical remission. However, after 10 years follow-up, the recurrence rate was similar in the both groups [25]. A Retrospective study of patients with 30 functional and 20 silent corticotroph adenomas showed USP8 variants in 11 and 2 adenomas, respectively. There was no difference in sex, age, preoperative hormonal profile, and size of the adenomas between patients with and without USP8 variants. However, the USP8-mutated tumors revealed a higher rate of invasiveness. Furthermore, somatostatin receptor 5 (SSRT5) was more frequent in USP8-mutated adenomas [26]. In a retrospective study of FCA patients found no difference considering age at the presentation and hormonal profile between patients with and without USP8 variants. However, macro-adenoma was more frequently seen in USP8-mutated patients. Although initial remission rate was similar in the both groups, after a median 5 (2–8) years of follow-up, USP8-mutated carriers were more likely to develop recurrence [27]. The study conducted by Bujko et al., comparing patients with USP8 mutated and wild-type corticotroph adenomas, demonstrated no difference in age, sex, preoperative hormonal profile, tumor invasiveness, proliferation index, and histology (sparsely vs. densely granulation) between the two groups. However, the USP8-mutated patients showed a higher rate of remission [28].
A cohort of Asian-Indian patients with CD identified that there was no significant difference considering age, sex, tumor size, tumor invasion, and preoperative hormonal profile of the participants with and without the USP8 variant. Moreover, the initial remission rate and long-term recurrence, after a mean follow-up of 25.3 ± 13.6 months, were also comparable in both groups [29]. Liu et al. investigated the expression of EGFR and its signaling pathways in FCAs. They demonstrated that EGFR was overexpressed in 29 of 52 patients with FCA. Moreover, the EGFR signal transducing molecules p-EGFR, p-Akt and p-Erk were upregulated in EGFR-overexpressing adenomas but not in EGFR-negative adenomas. Moreover, the expression of EGFR was positively correlated with ACTH and cortisol levels but not with age, sex, or adenoma size. After a mean follow-up of 42.8 months, 22 patients had tumor recurrence. The EGFR expression was positively associated with the recurrence rate [10].
USP8 and EGFR as potential therapeutic targets in functional corticotroph adenoma
Our systematic search yields nine studies investigating the possible role of the USP8 variant in response to the medications. Four studies evaluated the presence of SSTR5 receptors in USP8– mutated tumors. Genetic analysis of FCAs from a cohort of 39 functional and 23 silent corticotroph adenoma indicated that there was no difference regarding the age of the participants, as well as hormonal profile, size, and invasiveness of the tumor between patients with and without USP8 variants. However, USP8-mutated adenomas showed significantly higher SSRT5 expression compared to the wild-type ones [26].
In a cohort study, USP8-mutated FCA patients were dominantly women and showed lower ACTH levels and smaller tumor size, but no difference in cortisol level. Remission rate was significantly higher in USP8-mutated patients compared to the wild-type ones. Moreover, USP8-mutated adenomas were more likely to express SSTR5 [30]. Genetic analysis of 51 FFPE tumors (21 USP8-mutated and 30 wild-type) indicated significantly higher SSTR5 immunoreactivity score in USP8-mutated tumors, regardless of mutation type. Moreover, in vitro study of 24 corticotroph tumors freshly obtained after TSS indicated a significantly better response to Pasireotide treatment, defined as suppression of ACTH secretion, in human corticotroph tumors carrying USP8 variants [31].
A more recent study aimed to investigate the impact of USP8 variants on in vitro response to Pasirotide in primary cultures obtained from 7 FCAs and also in murine corticotroph tumor cells. USP8 variant in both primary cultured cells and AtT20 cells was associated with higher SSTR5 expression. Moreover, this study indicated although associated with SSTR5 upregulation, mutations at the amino acid 718 of USP8 are not associated with a favorable response to pasireotide, whereas USP8 variants at the amino acid 720 might preserve pasireotide responsiveness [32].
Inhibition of EGFR using Gefitinib, a tyrosine kinase inhibitor, in surgically resected human and canine corticotroph cultured tumors suppressed expression of POMC. Moreover, Blocking EGFR activity in mice attenuated POMC expression, inhibited corticotroph tumor cell proliferation, and induced apoptosis [33]. Araki et al. conducted a study to investigate the utility of EGFR as a therapeutic target for CD. EGFR expression was observed by 2.5 months in transgenic (Tg) mice; and aggressive ACTH-secreting pituitary adenomas with features of Crooke’s cells developed by 8 months with 65% penetrance observed. Moreover, they used the EGFR tyrosine kinase inhibitor Gefitinib to confirm reversibility of EGFR effects on ACTH. Gefitinib suppressed tumor POMC expression and downstream EGFR tumor signaling. Plasma ACTH level and pituitary tumor size was significantly lower in Gefitinib group [34].
Another experimental study investigated the effect of Lapatinib, a potent tyrosine kinase inhibitor, on ACTH production and cell proliferation in AtT-20 mouse corticotroph tumor cells. Lapatinib inhibits EGFR. In this study, Lapatinib decreased proopiomelanocortin (POMC) mRNA levels and ACTH levels in AtT-20 cells and also inhibited cell proliferation and induced apoptosis. Inhibition of EGFR signaling contributes to the inhibition of ACTH production and cell proliferation in corticotroph adenomas [35].
The effect of a potent and selective Jak2 inhibitor, SD1029, on ACTH production and proliferation investigated in mouse AtT20 corticotroph tumor cells. They observed that Jak2 inhibitor SD1029 decreased both POMC transcript levels and basal ACTH levels. These in vitro experiments suggest the Jak2 inhibitor suppresses both the autonomic synthesis and release of ACTH in corticotroph tumor cells. SD1029 was also found to inhibit AtT20-cell proliferation. In addition, SD1029 decreased and increased PTTG1 and GADD45β transcript levels, respectively. They seem to contribute, in part, in the Jak2-induced suppression of cell proliferation and ACTH synthesis [36]. An experimental study examined the effect of USP8 inhibitor on EGFR expression level, and cell viability using AtT20 cells treated with 9-ehtyloxyimino9H-indeno (1, 2-b) pyrazine-2,3-dicarbonitrile, a synthesized USP8 inhibitor. This study demonstrated that treatment with USP8 inhibitor, 9‑ehtyloxyimino9H‑indeno(1,2‑b) pyrazine‑2,3 dicarbonitrile, suppresses ACTH secretion, cell viability, and promotes cell apoptosis in AtT20 cells suggesting that USP8 inhibitor could be a new therapeutic candidate for CD [37].
Kageyama et al. investigated the effects of a potent USP8 inhibitor, DUBs-IN-2, on ACTH production and cell proliferation in mouse corticotroph tumor (AtT-20) cells. DUBs-IN-2 decreased Proopiomelanocortin (POMC) mRNA and ACTH levels. Furthermore, DUBs-IN-2 decreased At-20 cell proliferation and induced apoptosis in corticotroph tumor cells [38]. Another study explored the potential effect of the USP8 inhibitor RA-9 on USP8-WT human tumor corticotroph cells and murine AtT-20 cells. RA-9 significantly decreased cell proliferation and increased cell apoptosis in AtT-20 cells. Moreover, RA-9 reduced ACTH release by USP8-mutant cells. The combined treatment with RA-9 and pasireotide resulted in more efficient in inhibiting ACTH secretion compared with RA-9 or pasireotide alone. Furthermore, similar to pasireotide, RA-9 was able to significantly reduce phospho- ERK1/2 levels in both AtT-20 cells and primary cultured cells from corticotropinomas [39].
Another study, investigating the USP8 variants and genes involved in cell cycle regulation, looked for the role of USP8 variants or a changed p27 level in the response to Palbociclib, Flavopiridol, and Roscovitine, in vitro, using murine corticotroph AtT-20/D16v-F2 cells. They did not found any significant difference in cell viability or cell proliferation between the AtT-20/D16v-F2 cells overexpressing wild-type and mutated USP8 that were treated with cell cycle inhibitors. There was also no difference in the response to inhibitors of CKDs in the cells with overexpression of p27 and control cells [17].
Analytical conclusion
In our series, we found two USP8 variants including a 7-bp deletion variant, c.2151_2157delCTCCTCC, p. Ser718GlnfsTer3, and a missense variant, c.2159 C > G, p. Pro720Arg (rs672601311) in exon 14. Moreover, the systematic review of the published data indicated that 35% of corticotroph adenomas harbor USP8 variant the most of which was found in the 720 code region, p. Pro720Arg. Similar to the most previous studies, the USP-8 mutated patients were women, presented with micro-adenoma and experienced recurrence after initial remission.
We systematically reviewed the literature regarding the USP8 variant in corticotroph adenomas and classified the results into three categories; including USP8 variants and the related pathways, genotype-phenotype correlation in USP8-mutated individuals, and USP8 and EGFR as potential therapeutic targets.
Different USP8 variants are identified in corticotroph adenomas. Activation of the EGFR pathway is a well-established consequence of USP8 variants [6, 15]. But there is inconsistency regarding the role of USP8 variants in cell cycle regulation in corticotroph adenomas. Some studies showed no difference in the gene expression of the cell cycle regulators CDKN1B (P27), CCNE1 (CYCLIN-E1), CCND1 (CYCLIN-D1), CDK2, CDK4, and CDK6 according to USP8 variant status [21]; while the others indicated USP8-mutated tumors have lower CDKN1B, CDK6, CCND2 and higher CDC25A expression [20]. Moreover, demethylation of the first promoter is affected with USP8 variant status [19]. However, more studies are required to establish the pathway underlying the USP8 variants.
Data regarding sex, age, hormonal level, tumor size, and clinical outcomes in USP8-mutated individuals with FCA are relatively consistent among different studies. The USP8 variant seems to be associated with younger age and is more likely to occur in women. Meta-analysis of data from ten series indicated USP8 variant is 2.63 times higher in women than in men [40]. Since CD is more prevalent in young women, the potential effect of estrogen on the growth of USP8-mutant corticotroph cells has been hypothesized. There is evidence that corticotroph cells express estrogen receptors [41]. Moreover, in vitro studies indicated estrogen can stimulate corticotroph cell proliferation mediated by EGFR signaling pathways [42]. More precise studies are required to better explain the age-sex distribution of USP8 variant in patients with CD.
Results regarding the hormonal pattern among the series are partly controversial. Two series indicated significantly higher levels of ACTH and UFC in USP8-mutated patients compared to the wild-type ones [7, 24]. Moreover, one study demonstrated the expression levels of EGFR were positively correlated with ACTH and cortisol levels [10]. Conversely, one study showed a significantly lower ACTH level in patients with the USP8 variant [30]. However, in a systematic analysis of the two series the correlation of UFC and USP8 variant did not reach a significant difference, this might be due to the small number of cases included in the analysis [40].
There are also some discrepancies on tumor size and invasiveness in USP8-mutated tumors. Some studies indicated a significant smaller size in USP8-mutated tumors, while others showed a significant larger size in USP8-mutated tumors. But some study found no significant difference regarding tumor size and invasiveness between USP8-mutated and wild-type tumors. A recent systematic analysis of magnetic resonance imaging (MRI) findings from individuals with CD indicated USP8-mutated tumors are more likely to be less than 10 mm compared to wild-type ones [40]. Moreover, a cohort of 60 patients with FCA indicated smaller tumor size and less invasiveness in USP8-mutated tumors [30]. In contrast to these findings, a cohort of Brazilian patients observed a tendency toward more somatic USP8 variant in tumors more than 10 mm in size [40]. These discrepancies might be due to the different methods used for extraction of MRI data.
Considering the clinical outcomes, most studies indicated a higher remission rate except for one that showed a significantly lower rate of remission in USP8-mutated patients [22, 25, 28, 30]. Moreover, some studies demonstrated a higher rate of recurrence in carriers of USP8 variant [24, 27, 42]. However, other studies found no significant difference neither in the initial remission nor in the late recurrence rate between the carriers of USP8 variant and the individuals with wild-type USP8. The inconsistency in the results might be due to the lack of a systematic protocol for evaluation of these patients. Moreover, the number of patients included in the different studies was relatively low. Further multicenter prospective studies with the same protocol are required to yield more consistent information regarding the influence of USP8 variant on the clinical presentation as well as early and late outcomes of FCAs.
There are promising studies regarding USP8-targeted therapy. We found evidence that USP8-mutated tumors have higher SSRT5 expression [30, 31]. Moreover, in vitro studies demonstrated that Pasirotide suppressed ACTH secretion significantly more in the USP8-mutated tumors than in wild-type ones [31]. These evidences suggest that USP8 mutational status could be used as a marker of Pasirotide response in CD. Furthermore, USP8-mutated tumors are more likely to express EGFRs compared to the wild-type ones [6]. Inhibition of EGFR using Gefitinib and Lapatinib has been associated with promising results regarding the EGFR-targeting therapy in CD [33,34,35]. Moreover, experimental studies of two USP8 inhibitors, 9‑ehtyloxyimino9H‑indeno (1,2‑b) pyrazine‑2,3 dicarbonitrile and DUBs-IN-2, have shown their potential to suppress POMC expression and ACTH secretion, decrease cell proliferation, and promote apoptosis [37, 38].
In summary, the studies investigated the association of USP8– variants and clinical manifestations as well as clinical outcomes of the corticotroph adenomas are partly inconsistent. More precise multicenter studies are required to yield more consistent information regarding the phenotype-genotype correlation and to develop effective targeted therapies.
Data availability
The datasets used and/or analyzed during the current atudy are available from the corresponding author on reasonable request.
Abbreviations
ABI:
Applied Biosystems
ACTH:
Adrenocorticotropic Hormone
CCA:
Crooke Cell Adenomas
CD:
Cushing’s Disease
DNA:
Deoxyribonucleic Acid
EGFR:
Epidermal Growth Factor Receptor
Erk:
Extracellular Signal-Regulated Kinases
FCAs:
Functional Corticotroph Adenomas
FCPA:
Functional Corticotroph Pituitary Adenoma
FFPE:
Formalin-Fixed And Paraffin-Embedded
ICH-GCP:
International Conference On Harmonization Of Good Clinical Practice
IHC:
Immunohistochemistry
MRI:
Magnetic Resonance Imaging
PCR:
Polymerase Chain Reaction
PRISMA:
Preferred Reporting Items For Systematic Reviews And Meta-Analyses
RNA-seq:
RNA Sequencing
SCA:
Silent Corticotroph Adenomas
TSS:
Transsphenoidal Surgery
USP8:
Ubiquitin-Specific Peptidase
USP48:
Ubiquitin Specific Peptidase 48
References
Uwaifo GI, Hura DE. Hypercortisolism. [Updated 2023 Jul 4]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2023 Jan-. https://www.ncbi.nlm.nih.gov/books/NBK551526/.
Pivonello R, Simeoli C, Di Paola N, Colao A. Cushing’s disease: adrenal steroidogenesis inhibitors. Pituitary. 2022;25(5):726–32.
Balomenaki M, Vassiliadi DA, Tsagarakis S. Cushing’s disease: risk of recurrence following trans-sphenoidal surgery, timing and methods for evaluation. Pituitary. 2022;25(5):718–21.
Seltzer J, Ashton CE, Scotton TC, Pangal D, Carmichael JD, Zada G. Gene and protein expression in pituitary corticotroph adenomas: a systematic review of the literature. Neurosurg Focus. 2015;38(2):E17.
Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, Meitinger T, Mizuno-Yamasaki E, Kawaguchi K, Saeki Y, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8.
Ma ZY, Song ZJ, Chen JH, Wang YF, Li SQ, Zhou LF, Mao Y, Li YM, Hu RG, Zhang ZY, et al. Gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17.
Naviglio S, Mattecucci C, Matoskova B, Nagase T, Nomura N, Di Fiore PP, Draetta GF. UBPY: a growth-regulated human ubiquitin isopeptidase. EMBO J. 1998;17(12):3241–50.
Liu X, Feng M, Dai C, Bao X, Deng K, Yao Y, Wang R. Expression of EGFR in Pituitary Corticotroph Adenomas and its RelationshipWith Tumor Behavior. Front Endocrinol (Lausanne). 2019;10:785.
Nieman LK, Biller BM, Findling JW, Newell-Price J, Savage MO, Stewart PM, Montori VM. The diagnosis of Cushing’s syndrome: an endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab. 2008;93(5):1526–40.
Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, Köhrer K, Reifenberger G, Knobbe-Thomsen CB, Knappe UJ, Scholl UI. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–278.
Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D, et al. Ubiquitin-specific protease 8 mutant corticotrope Adenomas Present Unique secretory and molecular features and shed light on the role of Ubiquitylation on ACTH Processing. Neuroendocrinology. 2020;110(1–2):119–29.
Bujko M, Kober P, Boresowicz J, Rusetska N, Paziewska A, Dąbrowska M, Piaścik A, Pękul M, Zieliński G, Kunicki J, et al. USP8 mutations in corticotroph adenomas determine a distinct gene expression profile irrespective of functional tumour status. Eur J Endocrinol. 2019;181(6):615–27.
Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I, Gómez-Apo E, Espinosa-de-Los-Monteros AL, Portocarrero-Ortiz LA, Guinto G, et al. The genomic Landscape of Corticotroph tumors: from Silent Adenomas to ACTH-Secreting Carcinomas. Int J Mol Sci. 2022;23(9):4861.
Mossakowska BJ, Rusetska N, Konopinski R, Kober P, Maksymowicz M, Pekul M, Zieliński G, Styk A, Kunicki J, Bujko M. The expression of cell cycle-related genes in USP8-Mutated corticotroph neuroendocrine pituitary tumors and their possible role in cell cycle-targeting treatment. Cancers (Basel). 2022;14(22):5594.
Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, Petrangeli E, Losa M, Stalla GK, Pagotto U. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. 2004;183(2):385–94.
Araki T, Tone Y, Yamamoto M, Kameda H, Ben-Shlomo A, Yamada S, Takeshita A, Yamamoto M, Kawakami Y, Tone M, Melmed S. Two distinctive POMC promoters modify Gene expression in Cushing Disease. J Clin Endocrinol Metab. 2021;106(9):e3346–63.
Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Höfner K, Herterich S, Rotermund R, Ronchi CL, Buchfelder M, et al. Impact of USP8 gene mutations on protein deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46.
Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, Ye Z, Ji C, Zhang Y, He W, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing’s Disease. J Clin Endocrinol Metab. 2022;107(8):2296–306.
Perez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA, Faucz FR, Wildemberg LE, Assié G, Beschorner R, et al. The gene of the ubiquitin-specific protease 8 is frequently mutated in Adenomas causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004.
Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernández-Ramírez LC, Settas N, Angelousi A, Correa R, Papadakis GZ, Chittiboina P, et al. Somatic USP8 gene mutations are a Common cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43.
Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S, Honegger J, Flitsch J, Rachinger W, Buchfelder M. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018.
Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6.
Castellnou S, Vasiljevic A, Lapras V, Raverot V, Alix E, Borson-Chazot F, Jouanneau E, Raverot G, Lasolle H. SST5 expression and USP8 mutation in functioning and silent corticotroph pituitary tumors. Endocr Connect. 2020;9(3):243–53.
Treppiedi D, Barbieri AM, Di Muro G, Marra G, Mangili F, Catalano R, Esposito E, Ferrante E, Serban AL, Locatelli M, et al. Genetic profiling of a cohort of Italian patients with ACTH-Secreting pituitary tumors and characterization of a novel USP8 gene variant. Cancers (Basel). 2021;13(16):4022.
Bujko M, Kober P, Boresowicz J, Rusetska N, Zeber-Lubecka N, Paziewska A, Pekul M, Zielinski G, Styk A, Kunicki J, Ostrowski J, et al. Differential microRNA expression in USP8-Mutated and wild-type Corticotroph Pituitary tumors reflect the difference in protein ubiquitination processes. J Clin Med. 2021;10(3):375.
Abraham AP, Pai R, Beno DL, Chacko G, Asha HS, Rajaratnam S, Kapoor N, Thomas N, Chacko AG. USP8, USP48, and BRAF mutations differ in their genotype-phenotype correlation in Asian Indian patients with Cushing’s disease. Endocrine. 2022;75(2):549–59.
Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, Okada M, Nishioka H, Takeuchi Y, Komada M, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26.
Treppiedi D, Marra G, Di Muro G, Esposito E, Barbieri AM, Catalano R, Mangili F, Bravi F, Locatelli M, Lania AG, et al. P720R USP8 mutation is Associated with a better responsiveness to Pasireotide in ACTH-Secreting PitNETs. Cancers. 2022;14(10):2455.
Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, Melmed S. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. 2011;121(12):4712–21.
Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, Melmed S. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis, J Endocr Soc. 2017; 2017;1(2):127–143.
Asari Y, Kageyama K, Sugiyama A, Kogawa H, Niioka K, Daimon M. Lapatinib decreases the ACTH production and proliferation of corticotroph tumor cells. Endocr J. 2019;66(6):515–22.
Asari Y, Kageyama K, Nakada Y, Tasso M, Takayasu S, Niioka K, Ishigame N, Daimon M. Inhibitory effects of a selective Jak2 inhibitor on adrenocorticotropic hormone production and proliferation of corticotroph tumor AtT20 cells. Onco Targets Ther. 2017;10:4329–38.
Jian FF, Li YF, Chen YF, Jiang H, Chen X, Zheng LL, Zhao Y, Wang WQ, Ning G, Bian LG, Sun QF. Inhibition of Ubiquitin-specific peptidase 8 suppresses adrenocorticotropic hormone production and tumorous corticotroph cell growth in AtT20 cells. Chin Med J. 2016;129(17):2102–8.
Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. 2020;67(2):177–84.
Wanichi IQ, de Paula Mariani BM, Frassetto FP, Siqueira SAC, de Castro Musolino NR, Cunha-Neto MBC, Ochman G, Cescato VAS, Machado MC, Trarbach EB, et al. Cushing’s disease due to somatic USP8 mutations: a systematic review and meta-analysis. Pituitary. 2019;22(4):435–42.
Chaidarun SS, Swearingen B, Alexander JM. Differential expression of estrogen receptor-beta (ER beta) in human pituitary tumors: functional interactions with ER alpha and a tumor-specific splice variant. J Clin Endocrinol Metab. 1998;83(9):3308–15.
We thank all the participants enrolled in this study.
Funding
The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Iran University of Medical Sciences No. IR.IUMS.REC.1398.082.
Author information
Author notes
Nahid Hashemi-Madani and Sara Cheraghi are joint first authors.
Authors and Affiliations
Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, No. 10, Firoozeh St., Vali-asr Ave., Vali-asr Sq, Tehran, Iran
Nahid Hashemi-Madani, Sara Cheraghi, Zahra Emami & Mohammad E. Khamseh
Department of Pathology, Firoozgar hospital, Iran University of Medical Sciences, Tehran, Iran
Ali Zare Mehrjardi
Department of Endocrinology, Arad Hospital, Tehran, Iran
Mahmoud Reza Kaynama
Contributions
Conception and design: NHM and MEK; Development of methodology: NHM, SC and ZE; Acquisition, analysis, and interpretation of data: NHM, SC, ZE and AZM; Writing, review, and/or revision of the manuscript: NHM, SC, ZE, MRK and MEK; Administrative, technical or, material support: NHM, MEK; Study supervision: MEK; All authors read and approved the final manuscript.
This study was performed in accordance with the 1964 Helsinki Declaration, and was approved by the Ethics Committee of Iran University of Medical Sciences. Informed consent was obtained from all individual participants included in the study.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Additional file 1 of Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature
Skip to figshare navigation
Below is the link to the electronic supplementary material.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Hashemi-Madani, N., Cheraghi, S., Emami, Z. et al. Targeted analysis of Ubiquitin-Specific Peptidase (USP8) in a population of Iranian people with Cushing’s disease and a systematic review of the literature. BMC Endocr Disord24, 86 (2024). https://doi.org/10.1186/s12902-024-01619-z
Spontaneous remission of Cushing’s disease (CD) is uncommon and often attributed to pituitary tumor apoplexy. We present a case involving a 14-year-old female who exhibited clinical features of Cushing’s syndrome. Initial diagnostic tests indicated CD: elevated 24h urinary cortisol (235 µg/24h, n < 90 µg/24h), abnormal 1 mg dexamethasone overnight test (cortisol after 1 mg dex 3.4 µg/dL, n < 1.8 µg/dL), and elevated adrenocorticotropic hormone concentrations (83.5 pg/mL, n 10-60 pg/mL). A pituitary adenoma was suspected, so a nuclear MRI was performed, with findings suggestive of a pituitary microadenoma. The patient was referred for a transsphenoidal resection of the microadenoma. While waiting for surgery, the patient presented to the emergency department with a headache and clinical signs of meningism. A computed axial tomography of the central nervous system was performed, and no structural alterations were found. The symptoms subsided with analgesia. One month later, she presented again to the emergency department with clinical findings of acute adrenal insufficiency (cortisol level of 4.06 µg/dL), and she was noted to have spontaneous biochemical remission associated with the resolution of her symptoms of hypercortisolism. For that reason, spontaneous CD remission induced by pituitary apoplexy (PA) was diagnosed. The patient has been managed conservatively since the diagnosis and remains in clinical and biochemical remission until the present time, after 10 months of follow-up. There are three unique aspects of our case: the early age of onset of symptoms, the spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that the patient presented a microadenoma because there are fewer than 10 clinical case reports of PA associated with microadenoma.
Introduction
Cushing’s disease (CD) is characterized by excessive production of adrenocorticotropic hormone by a pituitary adenoma and represents the most common cause of endogenous Cushing’s syndrome (CS) [1]. CD was first reported in 1912 by Harvey Williams Cushing, and he described 12 cases at the Peter Bent Brigham Hospital in Baltimore [2]. This disease has a global incidence of approximately 2.2 cases per 1,000,000 people and occurs more frequently in women from 20 to 50 years of age [3]. Pituitary apoplexy (PA) is a rare condition that occurs in 2-12% of cases, and it has a high morbidity and mortality rate [4]. We report an interesting case of a woman diagnosed with CD who achieved spontaneous remission of her disease after a PA.
Case Presentation
A 14-year-old female presented with a two-year history of weight gain (32 kg), depression, elevated blood pressure, type 2 diabetes mellitus, and growth failure (height less than the third percentile). Her height was 140 cm, and her BMI was 28.1 (97th percentile). At presentation, she had not yet reached menarche. Physical examination revealed Tanner 2 breast development, acne, hirsutism, moon facies, dorsocervical fat pad, central obesity, and stretch marks. Initial laboratory tests showed hemoglobin A1C of 13%, low-density lipoprotein of 167 mg/dL, triglycerides of 344 mg/dL, high-density lipoprotein of 26 mg/dL, creatinine of 0.4 mg/dL, and elevated liver enzymes. Abdominal ultrasound indicated moderate hepatic steatosis changes.
Given the high suspicion of CS, a hormonal profile was conducted (Table 1), confirming CS and subsequently diagnosing CD. A nuclear MRI revealed a 2.6 × 1.8 mm pituitary lesion (Figure 1), prompting referral for transsphenoidal resection of the pituitary microadenoma.
Laboratories
Reference range
Initial
One month
Three months
Six months
TSH (mUI/L)
0.35-4.94
–
2.17
–
2.01
AM cortisol (µg/dL)
6.02-18.4
17.3
4.06
<0.5
4.7
1 mg DST (µg/dL)
<1.8
3.4
–
–
–
8 mg DST (µg/dL)
<50% suppression
1.9 (78% suppression)
–
–
–
Urine-free cortisol (µg/24h)
<90
235
–
–
–
ACTH (pg/mL)
10-60
83.5
–
19.2
9.7
IGF-1 (ng/mL)
36-300
–
–
–
293
Table 1: Pertinent laboratory investigation at baseline and follow-up with our patient
Figure 1: Axial view of a T1 MRI with contrast showing a sellar lesion
The red arrow shows a microadenoma in relation to the normal pituitary gland.
Approximately one month after the suppression tests and while awaiting surgery, the patient presented to the emergency department with a sudden, severe, holocranial headache accompanied by projectile vomiting and diplopia, suggestive of meningism. A computed axial tomography of the central nervous system was conducted, revealing no structural abnormalities. Symptoms resolved with intravenous analgesia within approximately four to six hours. Subsequently, the patient experienced a significant decrease in insulin requirements, ultimately leading to the suspension of insulin therapy due to persistent hypoglycemia.
Weeks after the headache episode, the patient was reevaluated in the emergency department with a three-day history of diffuse abdominal pain, vomiting, asthenia, myalgia, hypotension, tachycardia, orthostatism, and recurrent hypoglycemia despite insulin suspension. Acute adrenal insufficiency was suspected and confirmed by a cortisol level of 4.06 µg/dL. Treatment with intravenous hydrocortisone 50 mg every six hours was initiated, leading to complete resolution of symptoms within 72 hours. The patient was discharged on maintenance therapy with oral hydrocortisone (20 mg in the morning and 10 mg at night). Subsequent follow-ups showed undetectable cortisol levels. Currently, the patient has been followed up for 10 months post-event, showing persistent clinical and hormonal remission of her disease.
Discussion
CD represents approximately 80% of cases of endogenous hypercortisolism, and pituitary microadenomas are the most common cause of CD in all age groups [5]. CD prevalence is 0.3-6.2 cases per 100,000 people [3], which represents 4.4% of all pituitary adenomas [6], and it is up to five times more likely to occur in women than men. Spontaneous remission of CD is rare, and it is mainly due to the apoplexy of a pituitary tumor [7].
PA is a potentially fatal condition resulting from hemorrhage or necrosis of a pituitary adenoma that produces compression of the surrounding structures with symptoms that can be critical and even fatal [8]. PA affects between 2% and 12% of patients with pituitary adenomas, mainly in nonfunctional macroadenomas [9]. Although the main mechanism of PA is hemorrhage, it can also be due to a hemorrhagic infarction or an infarction without hemorrhage; this last scenario is clinically less aggressive [10]. Among the most important precipitating factors are craniocerebral trauma, pregnancy, thrombocytopenia, coagulopathies, pituitary stimulation tests, drugs such as anticoagulants and estrogens, surgeries that are complicated by hypotension, and radiotherapy [4,11,12].
There are three unique aspects of our case. First, the age of onset is 14 years old. This characteristic has been reported in less than 6% of cases of CD, with a mean age of onset between 12.3 and 14.1 years and a slightly higher incidence in men (63%) [13]. In this population, CD is the most common cause of hypercortisolism, accounting for 75-80% of all cases [14]. Furthermore, our patient presented a significant weight gain, severe compromise in her height, hypertension, depression, and diabetes mellitus, which is compatible with the classic profile described for CD in pediatric ages. It is important to clarify that although type 2 diabetes mellitus is common in adults, it is unusual in the pediatric population [13].
Second, spontaneous remission in CD due to apoplexy has been rarely reported in the past; hence, our case is an important addition to the scant literature on this unusual phenomenon. Although there are characteristics suggestive of PA, such as hyperdense lesions within the pituitary gland and the reinforcing ring, a CT scan has a low sensitivity for detecting pituitary hemorrhage (21-46%); therefore, a negative CT scan does not rule out PA in cases where there is infarction without hemorrhage, a situation that could correspond to our case [15].
The third unique feature of our case is that the stroke occurred in the context of a microadenoma, a situation reported in less than 10 cases in the literature. Despite being a microadenoma, the symptoms of PA were severe, with symptoms of meningism, an intense headache, vomiting, and the development of adrenal insufficiency. Taylor et al. [16] reported a similar case of a 41-year-old female with microadenoma whose PA was associated with severe headache and vomiting.
The main differential diagnosis in our case is cyclical CS (CCS), a disorder that occurs in 15% of CS cases, especially in CD [17]. The diagnosis of CCS is classically established with three peaks and two valleys in cortisol secretion, spontaneous fluctuations, and clinical features of CS [7]. The possibility of CCS was ruled out due to the typical presentation of the PA event and the persistence of hypocortisolism.
Finally, several cases of recurrence of their disease have been described after remission of CS due to AP. Those recurrences usually develop in follow-ups of up to seven years [18]. At the time of the last evaluation (10 months post-PA), the patient remained in remission, but long-term follow-up is required to detect both reactivation and hypopituitarism [19].
Conclusions
CD is a rare entity in the pediatric population, usually associated with a pituitary microadenoma. Spontaneous remission of this disease is very uncommon, but when it occurs, it is mainly due to PA. We describe a case with three unique aspects: CD with an early age of onset of symptoms, spontaneous remission of CD due to PA, which has been rarely reported in the medical literature, and the fact that there are less than 10 clinical case reports of PA associated with microadenoma. It is imperative for clinicians to be aware of this possible outcome in patients with CD.
I think members of the Cushing’s Help boards have been saying this forever! Cushing’s isn’t all that rare. Just rarely diagnosed,
BOSTON — The prevalence of Cushing syndrome (CS) in the United States may be considerably higher than currently appreciated, new data from a single US institution suggest.
In contrast to estimates of 1 to 3 cases per million patient-years from population-based European studies, researchers at the University of Wisconsin, Milwaukee, estimated that the incidence of CS in Wisconsin is a minimum of 7.2 cases per million patient-years. What’s more, contrary to all previous studies, they found that adrenal Cushing syndrome was more common than pituitary adrenocorticotropic hormone (ACTH)– secreting tumors (Cushing disease), and that fewer than half of individuals with adrenal Cushing syndrome had classic physical features of hypercortisolism, such as weight gain, round face, excessive hair growth, and stretch marks.
“Cases are absolutely being missed…. Clinicians should realize that cortisol excess is not rare. It may not be common, but it needs to be considered in patients with any constellation of features that are seen in cortisol excess,” study investigator Ty B. Carroll, MD, Associate Professor of Medicine, Endocrinology and Molecular Medicine, and the Endocrine Fellowship Program Director at Medical College of Wisconsin in Milwaukee, told Medscape Medical News.
There are several contributing factors, he noted, “including the obesity and diabetes epidemics which make some clinical features of cortisol excess more common and less notable. Providers get used to seeing patients with some features of cortisol excess and don’t think to screen. The consequence of this is more difficult-to-control diabetes and hypertension, more advance metabolic bone disease, and likely more advanced cardiovascular disease, all resulting from extended exposure to cortisol excess,” he said.
Are Milder Cases the Ones Being Missed?
Asked to comment, session moderator Sharon L. Wardlaw, MD, professor of medicine at Columbia University College of Physicians and Surgeons, New York City, said “When we talk about Cushing [syndrome], we usually think of pituitary ACTH as more [common], followed by adrenal adenomas, and then ectopic. But they’re seeing more adrenal adenoma…we are probably diagnosing this a little more now.”
She also suggested that the Wisconsin group may have a lower threshold for diagnosing the milder cortisol elevation seen with adrenal Cushing syndrome. “If you screen for Cushing with a dexamethasone suppression test…[i]f you have autonomous secretion by the adrenal, you don’t suppress as much…. When you measure 24-hour urinary cortisol, it may be normal. So you’re in this in-between [state]…. Maybe in Wisconsin they’re diagnosing it more. Or, maybe it’s just being underdiagnosed in other places.”
She also pointed out that “you can’t diagnose it unless you think of it. I’m not so sure that with these mild cases it’s so much that it’s more common, but maybe it’s like thyroid nodules, where we didn’t know about it until everybody started getting all of these CT scans. We’re now seeing all these incidental thyroid nodules…I don’t think we’re missing florid Cushing.”
However, Wardlaw said, it’s probably worthwhile to detect even milder hypercortisolism because it could still have long-term damaging effects, including osteoporosis, muscle weakness, glucose intolerance, and frailty. “You could do something about it and normalize it if you found it. I think that would be the reason to do it.”
Is Wisconsin Representative of Cushing Everywhere?
Carroll presented the findings at the annual meeting of the Endocrine Society. He began by noting that most of the previous CS incidence studies, with estimates of 1.2-3.2 cases per million per year, come from European data published from 1994 to 2019 and collected as far back as 1955. The method of acquisition of patients and the definitions of confirmed cases varied widely in those studies, which reported CS etiologies of ACTH-secreting neoplasms (pituitary or ectopic) in 75%-85% and adrenal-dependent cortisol excess in 15%-20%.
The current study included data from clinic records between May 1, 2017, and December 31, 2022, of Wisconsin residents newly diagnosed with and treated for CS. The CS diagnosis was established with standard guideline-supported biochemical testing and appropriate imaging. Patients with exogenous and non-neoplastic hypercortisolism and those who did not receive therapy for CS were excluded.
A total of 185 patients (73% female, 27% male) were identified from 27 of the total 72 counties in Wisconsin, representing a population of 4.5 million. On the basis of the total 5.9 million population of Wisconsin, the incidence of CS in the state works out to 7.2 cases per million population per year, Carroll said.
However, data from the Wisconsin Hospital Association show that the University of Wisconsin’s Milwaukee facility treated just about half of patients in the state who are discharged from the hospital with a diagnosis of CS during 2019-2023. “So…that means that an actual or approximate incidence of 14-15 cases per million per year rather than the 7.2 cases that we produce,” he said.
Etiologies were 60% adrenal (111 patients), 36.8% pituitary (68 patients), and 3.2% ectopic (6 patients). Those proportions were similar between genders.
On biochemical testing, values for late-night salivary cortisol, dexamethasone suppression, and urinary free cortisol were highest for the ectopic group (3.189 µg/dL, 42.5 µg/dL, and 1514.2 µg/24 h, respectively) and lowest for the adrenal group (0.236 µg/dL, 6.5 µg/dL, and 64.2 µg/24 h, respectively). All differences between groups were highly statistically significant, at P < .0001, Carroll noted.
Classic physical features of CS were present in 91% of people with pituitary CS and 100% of those ectopic CS but just 44% of individuals with adrenal CS. “We found that adrenal-dependent disease was the most common form of Cushing syndrome. It frequently presented without classic physical features that may be due to the milder biochemical presentation,” he concluded.
Carroll reports consulting and investigator fees from Corcept Therapeutics. Wardlaw has no disclosures.
Miriam E. Tucker is a freelance journalist based in the Washington DC area. She is a regular contributor to Medscape, with other work appearing in The Washington Post, NPR’s Shots blog, and Diatribe. She is on X (formerly Twitter) @MiriamETucker.
The success and outcomes of repeat endoscopic transsphenoidal surgery (ETS) for residual or recurrent Cushing’s disease (CD) are underreported in the literature. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in these patients.
Methods
A retrospective analysis was conducted on 56 patients who underwent a total of 65 repeat ETS performed by a single neurosurgeon between January 2006 and December 2020. Data including demographic, clinical, laboratory, radiological, and operative details were collected from electronic medical records. Logistic regression was utilized to identify potential predictors associated with sustained remission.
Results
Among the cases, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had prior endoscopic procedures. Remission was achieved in 47 (83.9%) patients after the first repeat ETS, with an additional 9 (16.1%) achieving remission after the second repeat procedure. During an average follow-up period of 97.25 months, the recurrence rate post repeat surgery was 6.38%. Sustained remission was achieved in 48 patients (85.7%), with 44 after the first repeat ETS and 4 following the second repeat ETS. Complications included transient diabetes insipidus (DI) in 5 (7.6%) patients, permanent (DI) in 2 (3%) patients, and one case (1.5%) of panhypopituitarism. Three patients (4.6%) experienced rhinorrhea necessitating reoperation. A serum cortisol level > 5 µg/dL on postoperative day 1 was associated with a reduced likelihood of sustained remission.
Conclusion
Repeat ETS is a safe and effective treatment option for residual or recurrent CD with satisfactory remission rates and low rates of complications.
Cushing’s disease (CD) arises from an adrenocorticotropic hormone (ACTH)-secreting pituitary adenoma, leading to excessive endogenous glucocorticoid production [1]. The reported incidence of CD varies from 0.7 to 2.4 cases per million individuals annually [2,3,4,5,6]. Hypercortisolism impacts every bodily system and is linked to elevated morbidity and mortality risks [7, 8]. Therefore, prompt CD diagnosis and management are crucial to enhance patient outcomes.
Transsphenoidal surgery remains the primary treatment for CD, and have been associated with satisfactory remission rates ranging from 65 to 94% [2, 3, 5, 9,10,11]. Two surgical techniques are utilized: microscopic and endoscopic approaches. While both methods are effective, studies indicate that endoscopic transsphenoidal surgery (ETS) offers higher rates of complete tumor removal and lower complication rates [12,13,14]. ETS holds advantages over microscopic transsphenoidal surgery (MTS) due to superior tumor visualization, especially for laterally invasive tumors and macroadenomas [15]. Since its introduction in 1997, ETS has gained popularity and is now the standard surgical approach for managing CD [16].
Remission rates post-ETS for CD treatment range from 77 to 90% [17,18,19,20,21,22]. Despite ETS’s technical benefits and favorable outcomes, recurrence rates for Cushing’s disease after successful ETS range between 5.6% and 22.8% [17, 18, 22, 23]. Reoperating for residual or recurrent CD presents challenges due to altered surgical landmarks and scar tissue formation from previous surgeries, potentially elevating morbidity, and mortality risks [24, 25]. Limited literature exists on the success and outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent CD. This study aims to address this gap by assessing the safety, feasibility, and efficacy of repeat ETS in patients with residual or recurrent Cushing’s disease.
Methods
Study design
This is a retrospective cohort study of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease. All patients underwent endoscopic endonasal transsphenoidal surgery by the senior author between 2006 and 2020. The study protocol was approved by the local ethics committee for clinical studies.
Patient selection
The study participants were selected based on specific inclusion and exclusion criteria. Inclusion criteria were as follows: (i) a confirmed diagnosis of Cushing’s disease, (ii) prior transsphenoidal surgery, and (iii) confirmation of residual or recurrent CD through clinical, laboratory, and/or imaging assessments. Exclusion criteria included: (i) prior craniotomy without transsphenoidal surgery, (ii) previous radiotherapy before reoperation, (iii) inaccessible clinical, laboratory, or radiological data, and (iv) follow-up duration of less than 6 months.
Diagnostic criteria
Each patient underwent thorough screening for active Cushing’s disease. An increased 24-hour urine cortisol level > 45 µg/day or a serum fasting cortisol level exceeding 1.8 µg/dl following a low-dose (2 mg) dexamethasone suppression test was deemed abnormal. Subsequently, a high-dose (8 mg) dexamethasone test was administered, and a reduction of 50% or more from the baseline value was indicative of active Cushing’s disease. Due to the technical limitations of the institution that the research has been done, late-night salivary cortisol tests were not performed. Early remission was characterized by a fasting serum cortisol level below 5 µg/dl on the 1st and 7th postoperative days. Patients displaying a serum cortisol level below 1.8 µg/dl after the low-dose dexamethasone suppression test or those requiring continued corticosteroid replacement post-surgery were considered to maintain remission. The presence of a residual adenoma on postoperative magnetic resonance imaging (MRI) confirmed residual disease.
Routine follow-up protocol
Patients were evaluated for Cushing’s disease symptoms before surgery and monitored at 6 months after surgery, as well as during yearly check-ups for any changes in their condition. Fasting serum ACTH and cortisol levels were measured in the morning before surgery, on the 1st and 7th days after surgery, at the 1st, 3rd, and 6th months, and during yearly follow-up appointments. Prior to surgery, all patients underwent contrast-enhanced pituitary MRI and paranasal sinus CT scans. Follow-up pituitary MRI scans were conducted on the 1st day, at 3 and 12 months after surgery, and then annually thereafter.
Data collection
Data from electronic medical records were gathered, encompassing demographic, clinical, laboratory, radiological, and operative details. Laboratory assessments comprised an anterior pituitary hormone panel (Follicle-stimulating hormone [FSH], Luteinizing hormone [LH], Thyroid-stimulating hormone [TSH], Prolactin [PRL], Growth hormone [GH]), serum electrolytes, preoperative and postoperative serum ACTH, and cortisol levels. Patient records, along with CT and MRI scans, were scrutinized to document preoperative tumor characteristics such as size, multifocality, relationship with the cavernous sinus, Hardy-Wilson classification of sellar destruction, and suprasellar extension. Tumors larger than 10 mm were classified as macroadenomas. The operative database was examined to collect data on previous surgeries, including the number and dates of prior procedures, as well as the surgical techniques utilized. Outcome measures comprised remission rates and surgical complications.
Statistical analysis
Statistical analysis was conducted utilizing SPSS 23.0 software (IBM, New York). Two-group comparisons were performed using Chi-square and Fisher’s exact tests for categorical variables and Student’s t-test for continuous variables. Categorical variables were presented as numbers and percentages, while continuous variables were presented as means ± SD or median [IQR]. Logistic regression was performed to investigate potential predictors linked to sustained remission. A p-value of < 0.05 was deemed statistically significant.
Results
Baseline characteristics
Supplementary File 1 displays the demographic characteristics of the patient cohort.
A retrospective analysis was conducted on 190 patients who underwent a total of 212 operations for CD at our department between January 2006 and December 2020. Among them, 56 patients, comprising 65 repeat endonasal transsphenoidal surgeries due to either recurrence (n = 18, 27.7%) or residual disease (n = 47, 72.3%), were identified. The majority of patients were female (n = 48, 85.7%), with a mean age of 37.6 ± 12.4 years. Of the 56 patients, 43 (76.8%) were referred from another institution. Most patients (n = 42, 75%) had undergone only one prior surgery, while 12 patients (21.4%) had a history of two previous surgeries, and 2 patients (3.6%) had undergone three prior surgeries before referral to our center. The average follow-up duration since the first repeat ETS was 97.2 ± 36.8 months. The mean time to recurrence was 80.2 ± 61.1 months (median 75 months, range 23.2 to 103.5 months).
Hormonal data
Table 1 depicts the preoperative and postoperative serum ACTH and cortisol levels. The average preoperative serum cortisol levels for the entire patient cohort stood at 18.7 ± 11.1 µg/dL (median 17, range 12-24.6). The median preoperative 24-hour urine free cortisol level was 237 µg /day [188.5–425.5]. On the initial postoperative day, the mean serum cortisol levels for all patients were 13.4 ± 13.8 µg/dL (median 6.4, range 1.7–21). In 46.2% of cases (n = 30), cortisol levels on the first postoperative day were below 5 µg/dL (< 2 µg/dL in 33.8%). A comparison of the mean preoperative and postoperative serum ACTH and cortisol levels between the groups with residual disease and recurrence is detailed in Table 1.
Table 1 Cohort overview and comparison of recurrence and residual disease groups
In the entire case cohort, there were 41 microadenomas (63.1%) and 24 macroadenomas (36.9%). Fifteen cases (23.1%) exhibited bifocal adenomas. Adenoma extension into the cavernous sinuses, indicated by cavernous sinus wall displacement, was present in 21 cases (32.3%), while invasion into the cavernous sinuses was observed in 10 cases (15.4%). Based on the Hardy-Wilson Classification, there were 38 Grade I adenomas (58.5%), 16 Grade II adenomas (24.6%), 6 Grade III adenomas (9.2%), and 5 Grade IV adenomas (7.7%). Thirty patients (46.2%) presented with Stage A adenoma, 7 (10.8%) with Stage B adenoma, 2 (3.1%) with Stage C adenoma, 1 (1.5%) with Stage D adenoma, and 25 (38.5%) with Stage E adenoma. As indicated in Table 1, there were no statistically significant differences between patients with residual disease and recurrence concerning radiological findings.
Surgical characteristics
A single surgeon conducted all 65 reoperations. Among these, 47 patients (72.3%) underwent repeat ETS due to residual disease, while 18 (27.7%) did so due to recurrence. The previous surgical technique was microscopic in 40 cases (61.5%) and endoscopic in 25 cases (38.5%). Microscopic transsphenoidal surgeries were exclusively performed at other institutions. There was a notable disparity between patients with residual disease and recurrence regarding the technique of the previous surgery. Residual disease occurrence following endoscopic transsphenoidal surgery was less frequent (n = 11/25, 44%) compared to after microscopic transsphenoidal surgery (n = 36/40, 90%; p < 0.001) (Table 1). Immunohistochemical staining of the specimens indicated that 55 cases (85%) exhibited ACTH-positive adenoma. Nevertheless, all patients with a negative pathology at the repeat surgery had a confirmed ACTH-adenoma at the first surgery. Of the 10 patients (15%) with a negative ACTH-positive adenoma pathology, two patients underwent inferior petrosal sinus sampling (IPSS) previously and were confirmed to have CD. Remaining patients did not undergo an additional inferior petrosal sinus sampling (IPSS) because all functional test results indicated a central source and MRI confirmed pituitary microadenoma in all cases. Notably, there are studies reporting that IPSS may not be required in patients with a sellar mass and a biochemical testing suggestive of CD [26, 27]. Additionally, we also explored both sides of the pituitary and confirmed the adenoma intraoperatively. Therefore, negative pathology in the repeat surgery is most likely due to sampling error.
Outcomes
As depicted in Fig. 1, among the 56 patients, 47 (83.9%) experienced initial remission following the first repeat ETS, while 9 (16.1%) still had residual adenoma. Within the group achieving initial remission, 44 patients (93.6%) maintained remission without the need for further surgeries, while 3 (6.4%) experienced recurrence during follow-up and required a second repeat ETS.
Fig. 1
Outcomes of repeat endoscopic transsphenoidal surgery for residual or recurrent Cushing’s disease
Among the 9 patients with residual disease after the first repeat ETS, 1 (11.1%) opted to defer further treatment, 1 (11.1%) received radiotherapy, 1 (11.1%) chose adrenalectomy, and 6 (66.7%) underwent a second repeat ETS. Of the 9 patients who underwent a second repeat ETS due to residual disease or recurrence, 4 (44.4%) sustained remission, 5 (55.6%) still had residual disease, but 3 of them deferred further treatment, 1 received radiotherapy, while 1 achieved remission after adrenalectomy. Overall, 78.5% (n = 51) of the entire case cohort achieved remission following repeat ETS. Representative cases are presented in Fig. 2.
Fig. 2
Case 1: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 49-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 14 years ago at an outside institution. Preoperative T2 (A), and T1 contrast-enhanced (B) MRI scans demonstrate a right-sided pituitary adenoma. Postoperative T2 (C), and T1 contrast-enhanced (D) MRI scans demonstrate total resection of the adenoma. Case 2: Preoperative and postoperative magnetic resonance imaging (MRI) scans of a 53-year-old female who underwent repeat endoscopic transsphenoidal surgery (ETS) due to recurrent Cushing’s disease and achieved remission. The patient underwent initial surgery 3 years ago at an outside institution. Preoperative T2 (E), and T1 contrast-enhanced (F) MRI scans demonstrate a left-sided pituitary adenoma, in close relation to ICA. Postoperative T2 (G), and T1 contrast-enhanced (H) MRI scans demonstrate total resection of the adenoma
Transient diabetes insipidus (DI) developed in 5 patients (7.6%), while 2 (3%) experienced permanent DI following repeat ETS. Intraoperative cerebrospinal fluid (CSF) leak occurred in 20 operations (30.7%). Three patients (4.6%) developed rhinorrhea and required reoperation. Five patients (7.6%) developed prolactin deficiency, 3 patients (4.6%) had GH deficiency, and another 3 patients (4.6%) had TSH deficiency requiring thyroxine replacement. Four patients (6.2%) had combined deficiencies in TSH, FSH, LH and prolactin, while one patient (1.5%) developed panhypopituitarism following the second repeat ETS.
Factors predisposing to unsuccessful repeat endoscopic transsphenoidal surgery
Among the 42 patients who underwent repeat ETS for residual disease, 9 (21.4%) still had residual disease after the first repeat ETS. We conducted a multivariable logistic regression analysis to explore potential risk factors for unsuccessful repeat ETS. However, the analysis did not reveal any significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size (Supplementary File 1).
Potential predictors of sustained remission
We conducted a multivariable logistic regression analysis to investigate possible predictors of sustained remission. The variables included in the analysis are detailed in Table 5. The results indicated that having a serum cortisol level exceeding 5 µg/dL on postoperative day 1 was linked to a decreased likelihood of achieving sustained remission (Odds ratio [OR] 0.09, 95% confidence interval [CI] 0.01–0.52, p = 0.006) (Table 2).
Table 2 Logistic regression analysis of potential predictors for continued remission
Transsphenoidal surgery remains the established standard for treating Cushing’s disease, with demonstrated remission rates ranging from 65 to 94%, contingent upon the surgeon’s expertise and remission criteria [2, 3, 5, 9,10,11]. The advent of endoscopic techniques has notably augmented this approach, offering wider visibility, reduced nasal trauma, and shorter hospital stays [16, 25, 28, 29]. While the effectiveness of ETS in managing CD is well-documented, literature on its efficacy in treating residual or recurrent cases is limited. Our study addresses this gap by assessing the safety, feasibility, and outcomes of repeat ETS for patients with persistent or recurrent Cushing’s disease.
In our study, 56 patients underwent 65 repeat ETS procedures for residual or recurrent Cushing’s disease. Mean follow-up duration was 97.2 ± 36.8 months, which is one of the longest follow-up durations that has been reported following repeat endoscopic transsphenoidal surgery [5, 30,31,32]. Of these patients, 40 (61.5%) had previously undergone microscopic surgery, while 25 (38.5%) had undergone prior endoscopic procedures. Importantly, a notable difference emerged between patients with residual disease and those experiencing recurrence regarding the prior surgical approach, with residual disease being less frequent after endoscopic surgery compared to microscopic surgery (p < 0.001). This variance was expected, as numerous studies have indicated that ETS yields a higher rate of complete resection compared to MTS [12,13,14].
After the first repeat ETS, 47 patients (83.9%) achieved remission, and 78.5% (n = 44) of them maintained remission at a mean follow-up of 97.2 months without requiring additional surgery. Limited data exists regarding the remission rates of CD following repeat transsphenoidal surgery, with reported rates ranging from 28.9 to 73% [33, 34, 35]. Burke et al. reported an immediate remission rate of 86.7% and a continued remission rate of 73.3% at follow-up after repeat ETS [36]. Among our patients who achieved remission after successful repeat ETS, 3 individuals (6.38%, n = 3/47) experienced recurrence after the first repeat ETS, with a mean time to recurrence of 45.6 months. The rates of CD recurrence following reoperation vary, with documented rates ranging between 22% and 63.2% [37, 38]. In our study, 9 patients required a second repeat ETS due to residual disease or recurrence. Of these, 4 (44.4%) achieved continued remission following the second repeat ETS, while 5 (55.6%) had residual disease; however, 4 of them deferred further treatment, and 1 achieved remission after adrenalectomy. In total, 47 patients (83.9%) in the entire patient cohort achieved remission following endoscopic transsphenoidal surgery and did not require further intervention.
Within our case cohort, among the 42 patients who underwent repeat ETS for residual disease, 9 individuals (21.4%) continued to exhibit residual disease following the first repeat ETS. We did not establish a significant association between the success of repeat ETS and factors such as extension or invasion into cavernous sinuses, sellar or parasellar extension, or tumor size.
The degree of hypocortisolism following transsphenoidal surgery is considered a potential indicator of remission in the postoperative period [3]. Numerous studies have indicated that patients with subnormal postoperative cortisol levels tend to experience a lower recurrence rate compared to those with normal or supranormal levels, although consensus on the precise cutoff level remains elusive [30,31,32, 39]. In a retrospective study involving 52 patients with CD, researchers reported a 100% positive predictive value of a postoperative nadir cortisol level < 2 µg/dL for achieving remission [5]. Additionally, Esposito et al. observed that a morning serum cortisol level ≤ 5 µg/dL on postoperative day 1 or 2 appears to serve as a reliable predictor of remission [11]. In our investigation, logistic regression analysis revealed that patients with a serum cortisol level > 5 µg/dL on postoperative day 1 were less inclined to achieve continued remission compared to those with a serum cortisol level < 5 µg/dL on postoperative day 1.
Repeat transsphenoidal surgery presents unique challenges due to distorted surgical landmarks and the presence of scar tissue from prior procedures, often resulting in lower cure rates and increased morbidity risk [24, 25, 28]. Non-surgical options such as radiotherapy and radiosurgery have been considered as an effective treatment option for recurrent or residual CD due to low rates of morbidity and acceptable remission rates [28, 40]. However, our findings suggest that the outcomes and complication rates associated with repeat ETS are comparable to primary ETS for CD and superior to other non-surgical options for residual or recurrent CD. Within our patient cohort, 5 (7.6%) individuals experienced transient diabetes insipidus (DI), while 2 (3%) developed permanent DI. Additionally, one patient (1.5%) experienced panhypopituitarism following the second repeat ETS. Similarly, various studies have reported DI rates ranging from 2 to 13% and panhypopituitarism rates between 2% and 9.7% [25, 28, 41,42,43]. In our series, 3 (5.3%) patients developed rhinorrhea and required reoperation, consistent with reported rates of postoperative CSF leak ranging from 1 to 5% following repeat endoscopic transsphenoidal surgery for residual or recurrent pituitary tumors [25, 28, 44]. While radiotherapy and radiosurgery are options for patients who have failed transsphenoidal surgery or experienced recurrence, the literature suggests remission rates ranging from 46 to 84%, with several studies indicating high recurrence rates (25-50%) following radiotherapy [40, 45,46,47]. In our study, among 56 patients, 47 (83.9%) achieved remission following the first repeat ETS, while 4 (17.8%) achieved remission after the second repeat ETS. Over a mean follow-up duration of 97.25 months, our recurrence rate following repeat ETS was 27.7%, with a mean time to recurrence of 45.62 months.
At our institution, we adhere to a specific algorithm (Fig. 3) for managing Cushing’s disease patients and implement a meticulous protocol for individuals undergoing repeat ETS for residual or recurrent CD. A thorough clinical and radiological assessment is conducted for all patients before surgery. Detailed radiological evaluation is particularly essential to identify any distortions in surgical landmarks from prior procedures, such as the course of sphenoidal septa and the location of the sellar floor opening, as well as other potential aberrations like internal carotid artery and optic nerve dehiscence. Imaging techniques should encompass dynamic pituitary MRI with and without contrast and paranasal CT scans. Our objective is to achieve extensive exposure during surgery, which is especially critical for managing bifocal adenomas or adenomas with cavernous sinus invasion or extension. The expanded visual field also facilitates the visualization of concealed parts of the adenoma, allowing the surgeon to achieve complete resection, which may be challenging or even impossible with limited exposure. We employ a multilayer closure technique to prevent CSF leaks, and if necessary, utilize a vascularized pedicled nasoseptal flap (Hadad-Bassagasteguy flap).
Fig. 3
Specific algorithm for the management of Cushing’s disease patients
In summary, our findings suggest that in the hands of experienced surgeons, repeat ETS represents a safe and effective treatment option for managing residual or recurrent Cushing’s disease.
Strengths and limitations
Our study represents one of the largest case series in the literature examining the safety, feasibility, and efficacy of repeat ETS for managing recurrent or residual CD. Our findings underscore the safety and efficacy of repeat ETS in experienced centers, showcasing satisfactory remission rates and minimal complications. However, it is important to acknowledge the retrospective nature of our study, which inherently introduces potential biases such as selection bias. Lastly, our study exclusively focuses on patients undergoing surgical intervention for recurrent or residual CD, limiting our ability to compare the effectiveness of surgical treatment with alternative modalities like radiotherapy or radiosurgery.
Conclusion
Our study underscores the efficacy and safety of repeat endoscopic transsphenoidal surgery in managing residual or recurrent Cushing’s disease. Remarkably, 82.1% of patients achieved remission after their first reoperation, aligning closely with reported remission rates following primary endoscopic transsphenoidal surgery. Furthermore, the complication rates observed in our cohort were consistent with documented rates for both primary and repeat transsphenoidal surgeries. Notably, patients with serum cortisol levels < 5 µg/dL are more likely to maintain remission. Overall, our findings emphasize that in the hands of experienced surgeons, repeat endoscopic transsphenoidal surgery emerges as a reliable and safe treatment modality for residual or recurrent Cushing’s disease, offering satisfactory remission rates and minimal complications.
Data availability
No datasets were generated or analysed during the current study.
Abbreviations
ACTH:
adrenocorticotropic hormone
CD:
Cushing’s disease
CT:
computed tomography
DI:
diabetes insipidus
ETS:
endoscopic endonasal transsphenoidal surgery
MRI:
magnetic resonance imaging
MTS:
microscopic transsphenoidal surgery
References
Cushing H (1994) The basophil adenomas of the pituitary body and their clinical manifestations (pituitary basophilism). 1932. Obes Res 2(5):486–508
Aranda G, Enseñat J, Mora M, Puig-Domingo M, Martínez de Osaba MJ, Casals G et al (2015) Long-term remission and recurrence rate in a cohort of Cushing’s disease: the need for long-term follow-up. Pituitary 18(1):142–149
Hameed N, Yedinak CG, Brzana J, Gultekin SH, Coppa ND, Dogan A et al (2013) Remission rate after transsphenoidal surgery in patients with pathologically confirmed Cushing’s disease, the role of cortisol, ACTH assessment and immediate reoperation: a large single center experience. Pituitary 16(4):452–458
Acebes JJ, Martino J, Masuet C, Montanya E, Soler J (2007) Early post-operative ACTH and cortisol as predictors of remission in Cushing’s disease. Acta Neurochir (Wien). ;149(5):471-7; discussion 7–9
Fernandez-Rodriguez E, Stewart PM, Cooper MS (2009) The pituitary-adrenal axis and body composition. Pituitary 12(2):105–115
van Haalen FM, Broersen LH, Jorgensen JO, Pereira AM, Dekkers OM (2015) Management of endocrine disease: mortality remains increased in Cushing’s disease despite biochemical remission: a systematic review and meta-analysis. Eur J Endocrinol 172(4):R143–R149
Locatelli M, Vance ML, Laws ER (2005) Clinical review: the strategy of immediate reoperation for transsphenoidal surgery for Cushing’s disease. J Clin Endocrinol Metab 90(9):5478–5482
Blevins LS Jr., Christy JH, Khajavi M, Tindall GT (1998) Outcomes of therapy for Cushing’s disease due to adrenocorticotropin-secreting pituitary macroadenomas. J Clin Endocrinol Metab 83(1):63–67
Esposito F, Dusick JR, Cohan P, Moftakhar P, McArthur D, Wang C et al (2006) Clinical review: early morning cortisol levels as a predictor of remission after transsphenoidal surgery for Cushing’s disease. J Clin Endocrinol Metab 91(1):7–13
Guo S, Wang Z, Kang X, Xin W, Li X (2021) A Meta-analysis of endoscopic vs. microscopic transsphenoidal surgery for non-functioning and functioning pituitary adenomas: comparisons of efficacy and safety. Front Neurol. ;12
Gao Y, Zhong C, Wang Y, Xu S, Guo Y, Dai C et al (2014) Endoscopic versus microscopic transsphenoidal pituitary adenoma surgery: a meta-analysis. World J Surg Oncol 12:94
Yu SY, Du Q, Yao SY, Zhang KN, Wang J, Zhu Z, Jiang XB (2018) Outcomes of endoscopic and microscopic transsphenoidal surgery on non-functioning pituitary adenomas: a systematic review and meta-analysis. J Cell Mol Med 22(3):2023–2027
Broersen LHA, van Haalen FM, Biermasz NR, Lobatto DJ, Verstegen MJT, van Furth WR et al (2019) Microscopic versus endoscopic transsphenoidal surgery in the Leiden cohort treated for Cushing’s disease: surgical outcome, mortality, and complications. Orphanet J Rare Dis 14(1):64
Berker M, Işikay I, Berker D, Bayraktar M, Gürlek A (2014) Early promising results for the endoscopic surgical treatment of Cushing’s disease. Neurosurg Rev 37:105-114
Netea-Maier RT, van Lindert EJ, den Heijer M, van der Eerden A, Pieters GF, Sweep CG et al (2006) Transsphenoidal pituitary surgery via the endoscopic technique: results in 35 consecutive patients with Cushing’s disease. Eur J Endocrinol 154(5):675–684
Dehdashti AR, Gentili F (2007) Current state of the art in the diagnosis and surgical treatment of cushing disease: early experience with a purely endoscopic endonasal technique. Neurosurg Focus 23(3):E9
Starke RM, Reames DL, Chen CJ, Laws ER, Jane JA (2013) Jr. Endoscopic transsphenoidal surgery for cushing disease: techniques, outcomes, and predictors of remission. Neurosurgery 72(2):240–247 discussion 7
Cebula H, Baussart B, Villa C, Assié G, Boulin A, Foubert L et al (2017) Efficacy of endoscopic endonasal transsphenoidal surgery for Cushing’s disease in 230 patients with positive and negative MRI. Acta Neurochir (Wien) 159(7):1227–1236
Wagenmakers MA, Boogaarts HD, Roerink SH, Timmers HJ, Stikkelbroeck NM, Smit JW et al (2013) Endoscopic transsphenoidal pituitary surgery: a good and safe primary treatment option for Cushing’s disease, even in case of macroadenomas or invasive adenomas. Eur J Endocrinol 169(3):329–337
Esquenazi Y, Essayed WI, Singh H, Mauer E, Ahmed M, Christos PJ, Schwartz TH (2017) Endoscopic endonasal Versus Microscopic Transsphenoidal surgery for recurrent and/or residual pituitary adenomas. World Neurosurg 101:186–195
Cavallo LM, Solari D, Tasiou A, Esposito F, de Angelis M, D’Enza AI, Cappabianca P (2013) Endoscopic endonasal transsphenoidal removal of recurrent and regrowing pituitary adenomas: experience on a 59-patient series. World Neurosurg 80(3–4):342–350
Perlman JE, Johnston PC, Hui F et al (2021) Pitfalls in performing and interpreting Inferior Petrosal Sinus Sampling: personal experience and literature review. J Clin Endocrinol Metab 106(5):e1953–e1967. https://doi.org/10.1210/clinem/dgab012
Yogi-Morren D, Habra MA, Faiman C et al (2015) Pituitary MRI findings in patients with pituitary and ectopic ACTH-dependent cushing syndrome: does a 6-mm pituitary tumor size cut-off value exclude ectopic ACTH syndrome? Endocr Pract 21(10):1098–1103
Negm HM, Al-Mahfoudh R, Pai M, Singh H, Cohen S, Dhandapani S et al (2017) Reoperative endoscopic endonasal surgery for residual or recurrent pituitary adenomas. J Neurosurg 127(2):397–408
Chee GH, Mathias DB, James RA, Kendall-Taylor P (2001) Transsphenoidal pituitary surgery in Cushing’s disease: can we predict outcome? Clin Endocrinol (Oxf) 54(5):617–626
Atkinson AB, Kennedy A, Wiggam MI, McCance DR, Sheridan B (2005) Long-term remission rates after pituitary surgery for Cushing’s disease: the need for long-term surveillance. Clin Endocrinol (Oxf) 63(5):549–559
Yap LB, Turner HE, Adams CB, Wass JA (2002) Undetectable postoperative cortisol does not always predict long-term remission in Cushing’s disease: a single centre audit. Clin Endocrinol (Oxf) 56(1):25–31
Liu X, Dai C, Bao X, Deng K, Yao Y, Sun B et al (2021) Treatment and outcomes of recurrent/persistent Cushing’s disease: a single-center experience. Ann Palliat Med 10(3):2494–2504
Wang B, Zheng S, Ren J, Zhong Z, Jiang H, Sun Q et al (2022) Reoperation for Recurrent and Persistent Cushing’s Disease without Visible MRI Findings. J Clin Med 11(22): 6848
Burke WT, Penn DL, Repetti CS, Iuliano S, Laws ERJ (2019) Outcomes after repeat transsphenoidal surgery for recurrent Cushing Disease: updated. Neurosurgery 85(6):E1030–E6
Dickerman RD, Oldfield EH (2002) Basis of persistent and recurrent cushing disease: an analysis of findings at repeated pituitary surgery. J Neurosurg 97(6):1343–1349
Tajudeen BA, Mundi J, Suh JD, Bergsneider M, Wang MB (2015) Endoscopic endonasal surgery for recurrent pituitary tumors: technical challenges to the surgical approach. J Neurol Surg B Skull Base 76(1):50–56
Hwang JM, Kim YH, Kim JW, Kim DG, Jung HW, Chung YS (2013) Feasibility of endoscopic endonasal approach for recurrent pituitary adenomas after microscopic trans-sphenoidal approach. J Korean Neurosurg Soc 54(4):317–322
Berker M, Hazer DB, Yücel T, Gürlek A, Cila A, Aldur M, Onerci M (2012) Complications of endoscopic surgery of the pituitary adenomas: analysis of 570 patients and review of the literature. Pituitary 15(3):288–300
Rudnik A, Zawadzki T, Wojtacha M, Bazowski P, Zubgałuszka-Ignasiak B, Duda I (2005) [Endoscopic transsphenoidal treatment of pituitary adenomas]. Neurol Neurochir Pol 39(1):17–23 discussion 4–5
Estrada J, Boronat M, Mielgo M, Magallón R, Millan I, Díez S et al (1997) The long-term outcome of pituitary irradiation after unsuccessful transsphenoidal surgery in Cushing’s disease. N Engl J Med 336(3):172–177
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.